Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: F2 TTG
Vector Backbone Description: Backbone Size:2877; Vector Backbone:pBlueScript II SK(+); Vector Types:Cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21937602
Proper citation: RRID:Addgene_30733 Copy
Species: Xanthamonas oryzae
Genetic Insert: repeat HD5
Vector Backbone Description: Backbone Size:2989; Vector Backbone:pTC14; Vector Types:; Bacterial Resistance:Tetracycline
Defining Citation: PMID:21493687
Proper citation: RRID:Addgene_30978 Copy
Genetic Insert: F3 GAC
Vector Backbone Description: Backbone Size:2877; Vector Backbone:pBlueScript II SK(+); Vector Types:Cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21937602
Proper citation: RRID:Addgene_30738 Copy
Genetic Insert: F3 CGG
Vector Backbone Description: Backbone Size:2877; Vector Backbone:pBlueScript II SK(+); Vector Types:Cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21937602
Proper citation: RRID:Addgene_30737 Copy
Species: Xanthamonas oryzae
Genetic Insert: repeat NN4
Vector Backbone Description: Backbone Size:2989; Vector Backbone:pTC14; Vector Types:; Bacterial Resistance:Tetracycline
Defining Citation: PMID:21493687
Proper citation: RRID:Addgene_31010 Copy
Species: Xanthamonas oryzae
Genetic Insert: repeat NN5
Vector Backbone Description: Backbone Size:2989; Vector Backbone:pTC14; Vector Types:; Bacterial Resistance:Tetracycline
Defining Citation: PMID:21493687
Proper citation: RRID:Addgene_31011 Copy
Species: Xanthamonas oryzae
Genetic Insert: repeat NN8
Vector Backbone Description: Backbone Size:2989; Vector Backbone:pTC14; Vector Types:; Bacterial Resistance:Tetracycline
Defining Citation: PMID:21493687
Proper citation: RRID:Addgene_31014 Copy
Species: Xanthamonas oryzae
Genetic Insert: repeat NN9
Vector Backbone Description: Backbone Size:2989; Vector Backbone:pTC14; Vector Types:; Bacterial Resistance:Tetracycline
Defining Citation: PMID:21493687
Proper citation: RRID:Addgene_31015 Copy
Genetic Insert: F2 GCC
Vector Backbone Description: Backbone Size:2877; Vector Backbone:pBlueScript II SK(+); Vector Types:Cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21937602
Proper citation: RRID:Addgene_30721 Copy
Genetic Insert: LacZ + BsaI restriction sites
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2447; Vector Backbone:pCR8; Vector Types:; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:21493687
Proper citation: RRID:Addgene_31018 Copy
Species: Danio rerio
Genetic Insert: F2 GCT
Vector Backbone Description: Backbone Size:6141; Vector Backbone:pCS2; Vector Types:mRNA production; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21937602
Proper citation: RRID:Addgene_30723 Copy
Genetic Insert: F2 GCG
Vector Backbone Description: Backbone Size:2877; Vector Backbone:pCS2 (modified); Vector Types:mRNA production; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21937602
Proper citation: RRID:Addgene_30722 Copy
Genetic Insert: LacZ + BsaI restriction sites
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2447; Vector Backbone:pCR8; Vector Types:; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:21493687
Proper citation: RRID:Addgene_31019 Copy
Genetic Insert: F2 GGC
Vector Backbone Description: Backbone Size:2877; Vector Backbone:pCS2 (modified); Vector Types:mRNA production; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21937602
Proper citation: RRID:Addgene_30725 Copy
Genetic Insert: F2 GTA
Vector Backbone Description: Backbone Size:2877; Vector Backbone:pBlueScript II SK(+); Vector Types:Cloning vector; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21937602
Proper citation: RRID:Addgene_30727 Copy
Species: Homo sapiens
Genetic Insert: reticulon 3
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pcDNA3.1/myc-His(-)B (invitrogen); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:17182608
Proper citation: RRID:Addgene_31087 Copy
Genetic Insert: 5xoligonucleotides eGFPutr
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:15919892
Comments: GFPutrNotF oligo sequence - CGCAGCGGCCGCGCAAGCTGACCCTGAAGTTCAGCAAGCTGACCCTGAAGTTCAGCAAGCTGACCCTGAAGTTCAGCAAGCTGACCCTGAAGTTCAGAAT.
This is similar to the reporter described in the manuscript, “pD2eGFP-6XUTR.” This is designed to be especially sensitive to regulation by the InvivoGen commercial GFP shRNA and therefore has 3 extra perfect complementary shRNA binding sites and one imperfect in the 3’ UTR for a total of 5 possible shRNA docking sites (1 in coding region, 4 in 3’ UTR). The pD2eGFP-5XUTR construct is similar to the pD2eGFP-6XUTR construct in its increased susceptibility to regulation by the InvivoGen shRNA.
Proper citation: RRID:Addgene_31121 Copy
Genetic Insert: GFP(FRT)lacZ
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pCS2+; Vector Types:Mammalian Expression, FLP/FRT; Bacterial Resistance:Ampicillin
Defining Citation: PMID:11376165
Comments: FLP reporter: from green protein fluorescence to lacZ
Proper citation: RRID:Addgene_31124 Copy
Species: Homo sapiens
Genetic Insert: ACE2 promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4800; Vector Backbone:pGL3-Basic; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:16297991
Comments: promoter luciferase reporter
Please note that there are some small discrepancies between Addgene's quality control sequence and the assembled sequence from the depositor. These discrepancies should not affect the function of the plasmid.
Proper citation: RRID:Addgene_31111 Copy
Species: Homo sapiens
Genetic Insert: euchromatic histone-lysine N-methyltransferase 2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:6963; Vector Backbone:pLenti6/V5-D-TOPO; Vector Types:Mammalian Expression, Lentiviral; Bacterial Resistance:Ampicillin
Comments: Spektor TM, Rice JC. Identification and characterization of posttranslational modification-specific binding proteins in vivo by mammalian tethered catalysis. Proc Natl Acad Sci U S A. 2009 Sep 1;106(35):14808-13. Epub 2009 Aug 18.
Proper citation: RRID:Addgene_31113 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
