Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Issues Status:no known issues (facet)

Facets


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

739,718 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pCMV-Tag1-NS5A
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_17646 HCV NS5A Hepatitis C virus Kanamycin PMID:17404395 Backbone Marker:Stratagene; Backbone Size:4300; Vector Backbone:pCMVTag1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-01 01:08:57 4
Flag-hCRM1
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_17647 CRM1 Homo sapiens Ampicillin PMID:16041368 Backbone Marker:Sigma; Backbone Size:6400; Vector Backbone:p3xFLAG CMV-10; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-01 01:08:57 14
pCS2-MT GLI2 delta N
 
Resource Report
Resource Website
10+ mentions
RRID:Addgene_17649 GLI2 Homo sapiens Ampicillin PMID:15994174 Backbone Size:4350; Vector Backbone:pCS2-MT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Missing 328 N-terminal amino acids 2026-08-01 01:08:57 12
pTRERF1.1.0-gDNA
 
Resource Report
Resource Website
RRID:Addgene_176384 TRERF1 gRNA Homo sapiens Ampicillin gRNA sequence listed also includes (uncloned) PAM Backbone Marker:addgene ID: 42230; Vector Backbone:pX330; Vector Types:CRISPR; Bacterial Resistance:Ampicillin 2026-08-01 01:08:56 0
pGEM-Isce-Tol2-Tn5-neo
 
Resource Report
Resource Website
RRID:Addgene_176619 I-SceI sites, Tol2 repeats and Tn5-neo cassette Synthetic Ampicillin and Kanamycin PMID:34751773 Backbone Marker:Promega; Backbone Size:3000; Vector Backbone:pGEM-T; Vector Types:Unspecified; Bacterial Resistance:Ampicillin and Kanamycin 2026-08-01 01:08:58 0
pET29b-mVenus-dspB(E184Q W330Y)-6xHis
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_176577 Dispersin B Aggregatibacter actinomycetemcomitans Kanamycin PMID:35379435 Backbone Size:5313; Vector Backbone:pET29b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin E184Q W330Y 2026-08-01 01:08:58 1
Cry2PHR-IBAR-WH2
 
Resource Report
Resource Website
RRID:Addgene_176603 Cry2PHR-mCherry-IBAR-WH2 Homo sapiens Kanamycin PMID:35987384 Please visit https://www.biorxiv.org/content/10.1101/2022.01.28.478241v1 for bioRxiv preprint. Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-01 01:08:58 0
Cry2PHR - IBAR
 
Resource Report
Resource Website
RRID:Addgene_176602 Cry2PHR-mCherry-IBAR Homo sapiens Kanamycin PMID:35987384 Please visit https://www.biorxiv.org/content/10.1101/2022.01.28.478241v1 for bioRxiv preprint. Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-01 01:08:58 0
IBAR-Cry2PHR
 
Resource Report
Resource Website
RRID:Addgene_176604 IBAR-Cry2PHR-mCherry Homo sapiens Kanamycin PMID:35987384 Please visit https://www.biorxiv.org/content/10.1101/2022.01.28.478241v1 for bioRxiv preprint. Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-N1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-01 01:08:58 0
pM-TagRFP657
 
Resource Report
Resource Website
RRID:Addgene_176563 TagRFP657 Synthetic Ampicillin PMID:35314781 Please note: Plasmid contains E38G and L304S mutations in MET17. These mutations are not known to affect plasmid function. Vector Backbone:pM; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-01 01:08:58 0
pH-TagRFP657
 
Resource Report
Resource Website
RRID:Addgene_176560 TagRFP657 Synthetic Ampicillin PMID:35314781 Vector Backbone:pH; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin 2026-08-01 01:08:58 0
pSL1180-HR-PUbEGFP-NLS
 
Resource Report
Resource Website
RRID:Addgene_176681 EGFP Ae. Aegypti, Aequorea victoria Ampicillin PMID:34819517 Please visit https://www.biorxiv.org/content/10.1101/2021.03.29.437496v2 for bioRxiv preprint. Vector Backbone:pSL1180; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2026-08-01 01:08:59 0
MF87_PB-EF1a-TET3G-P2A-ERT2-Gal4-BGHpA
 
Resource Report
Resource Website
RRID:Addgene_176630 EF1a-TET3G-P2A-ERT2-Gal4-BGHpA Synthetic Ampicillin PMID:35050677 Backbone Marker:System Biosciences; Vector Backbone:PiggyBac transposon system; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-01 01:08:58 0
MF82_PB-TRE3G-12x42bs-10x(BCRbs_BCRbs)-miniCMV-NLS-FKBP12F36V-BCRZFR39A-VP16-NLS-DHFR-IRES-mCherry-PEST-BGHpA
 
Resource Report
Resource Website
RRID:Addgene_176626 TRE3G-12x42bs-10x(BCRbs_BCRbs)-miniCMV-NLS-FKBP12F36V-BCRZFR39A-VP16-NLS-DHFR-IRES-mCherry-PEST-BGHpA Synthetic Ampicillin PMID:35050677 Backbone Marker:System Biosciences; Vector Backbone:PiggyBac transposon system; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-01 01:08:58 0
MF85_PB-14xUAS-12x42bs-10x(ErbB2bs_ErbB2bs)-miniCMV-NLS-FKBP12F36V-ErbB2ZFR2AR39A-VP16-NLS-DHFR-IRES-mTurquoise2-PEST-BGHpA
 
Resource Report
Resource Website
RRID:Addgene_176629 14xUAS-12x42bs-10x(ErbB2bs_ErbB2bs)-miniCMV-NLS-FKBP12F36V-ErbB2ZFR2AR39A-VP16-NLS-DHFR-IRES-mTurquoise2-PEST-BGHpA Synthetic Ampicillin PMID:35050677 Backbone Marker:System Biosciences; Vector Backbone:PiggyBac transposon system; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-01 01:08:58 0
MF84_PB-14xUAS-6x42bs-6x(BCRbs_BCRbs)-miniCMV-NLS-FKBP12F36V-BCRZFR39A-VP16-NLS-DHFR-IRES-mCherry-PEST-BGHpA
 
Resource Report
Resource Website
RRID:Addgene_176628 14xUAS-6x42bs-6x(BCRbs_BCRbs)-miniCMV-NLS-FKBP12F36V-BCRZFR39A-VP16-NLS-DHFR-IRES-mCherry-PEST-BGHpA Synthetic Ampicillin PMID:35050677 Backbone Marker:System Biosciences; Vector Backbone:PiggyBac transposon system; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin 2026-08-01 01:08:58 0
BL21 Rosetta2 GamS
 
Resource Report
Resource Website
RRID:Addgene_176584 pRARE2 + pBADmod1-linker2-gamS plasmid Chloramphenicol and Ampicillin PMID:35034449 Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for genomic verification: Foward - tattttccagtcgtgaaagc Reverse - ttgctgatttcttccatcag Primers for GamS plasmid verification: Forward - aattatgacaacttgacggctacatcattc Reverse - cgttcaccgacaaacaaca Vector Backbone:Unknown; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-08-01 01:08:58 0
BL21 Rosetta2 ΔrecBCD
 
Resource Report
Resource Website
RRID:Addgene_176583 pRARE2 plasmid Chloramphenicol PMID:35034449 Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recBCD deletion verification: Foward - ttgatttactgcccgagagc Reverse - gtcaaccgaatgcagacatc Vector Backbone:Strain; Vector Types:; Bacterial Resistance:Chloramphenicol recBCD genomic deletion 2026-08-01 01:08:58 0
BL21 Rosetta2 ΔrecBCD GamS
 
Resource Report
Resource Website
RRID:Addgene_176586 pRARE2 + pBADmod1-linker2-gamS plasmid Chloramphenicol and Ampicillin PMID:35034449 Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recBCD deletion verification: Foward - ttgatttactgcccgagagc Reverse - gtcaaccgaatgcagacatc Primers for GamS plasmid verification: Forward - aattatgacaacttgacggctacatcattc Reverse - cgttcaccgacaaacaaca Vector Backbone:Strain; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin recBCD genomic deletion 2026-08-01 01:08:58 0
pHS0537 CRISPR-associated IscB locus (Delaware Bay) in pBR322 with Fn spacer
 
Resource Report
Resource Website
RRID:Addgene_176588 CRISPR-associate IscB (Delaware Bay) locus Delaware Bay metagenome Ampicillin PMID:34591643 Backbone Marker:NEB; Backbone Size:4361; Vector Backbone:pBR322; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin Replaced spacer in CRISPR array with Fn spacer 2026-08-01 01:08:58 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.