Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

742,877 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pET28a-MBP-(CBX1)3-eReader
 
Resource Report
Resource Website 		RRID:Addgene_135090 CBX1 chromobox protein 1, engineered x3 Homo sapiens Kanamycin PMID:31634430 Backbone Marker:Novagen; Backbone Size:-4; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin lysine 43 mutated to alanine; aspartic acid 59 mutated to phenylalanine 2026-09-19 02:09:24 0
pCZGY847
 
Resource Report
Resource Website 		RRID:Addgene_135093 Pacr-2 Caenorhabditis elegans Ampicillin PMID:20027209 Backbone Marker:Invitrogen Gateway; Backbone Size:4045; Vector Backbone:pDEST; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin 2026-09-19 02:09:24 0
pcDNA3 HA human NEMO
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_13512 NEMO Homo sapiens Ampicillin PMID:10358014 See "Author's Map" for more information. Backbone Marker:Made in Guan Lab; Backbone Size:5400; Vector Backbone:pcDNA3-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-19 02:09:24 10
pOO2-GW
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_135097 Chloramphenicol and Ampicillin PMID:21107422 The AtAMT1;1 coding sequence with the att sites (attB1 and attB2) from the pDRf1-AtAMT1;1 (Loque et al 2007 Nature 446 195-198) was remobilized with both restriction enzymes SpeI and XhoI then subsequently cloned between SpeI and XhoI sites in the p6013-002 (Ludewig et al., 2002 J. Biol. Chem. 277, 13548-13555). The AtAMT1;1 coding sequence was then replaced by the Gateway DNA cassette after a BP reaction with pDONR 221 (GATEWAY technology, Invitrogen) to generate the p002-GW vector. Backbone Size:5288; Vector Backbone:pOO2-GW; Vector Types:bacterial expression vector for generating SP6 transcripts in vitro for Xenopus oocyte transfection; Bacterial Resistance:Chloramphenicol and Ampicillin 2026-09-19 02:09:24 1
BOLL_RRM_pGEX
 
Resource Report
Resource Website 		RRID:Addgene_135130 BOLL Homo sapiens Ampicillin PMID:29883606 Backbone Marker:Promega; Backbone Size:5081; Vector Backbone:pGEX-6P-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-19 02:09:24 0
pcDNA3 Flag FKHR H215R AAA mutant
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_13510 FKHR H215R AAA Homo sapiens Ampicillin PMID:10358014 See "Author's Map" for map of wild-type pcDNA3-flag-FKHR. Backbone Marker:made in Guan Lab; Backbone Size:5000; Vector Backbone:pcDNA3 Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin H215R T24A S256A S319A 2026-09-19 02:09:24 1
pcDNA5FRTTO-codoptUL23-CStHA
 
Resource Report
Resource Website 		RRID:Addgene_135099 HSV-1 UL23 codon optimized Synthetic Ampicillin PMID:31653857 Vector Backbone:pcDNA5/FRT/TO/NHASt; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-19 02:09:24 0
3xIRS luciferase
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_13511 3xIRS Homo sapiens Ampicillin PMID:10358014 Two oligonucleotides (GCAAAACAAACTTATTTTGAAGCAAAACAAACTTATTTTGAAGCAAAACAAACTTATTTTGAA and TCGATTCAAAATAAGTTTGTTTTGCTTCAAAATAAGTTTGTTTTGCTTCAAAATAAGTTTGTTTTGCGTAC) were annealed together and ligated into the pGL2-Promoter vector (Promega) to create 3×IRS-luciferase. The IRS sequences were derived from human IGFBP-1's IRS. See "Author's Map" for more information. Backbone Marker:Promega; Backbone Size:5800; Vector Backbone:pGL2-Promoter; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2026-09-19 02:09:24 4
RBMS2_2xRRM_pGEX
 
Resource Report
Resource Website 		RRID:Addgene_135132 RBMS2 Homo sapiens Ampicillin PMID:29883606 Backbone Marker:Promega; Backbone Size:5081; Vector Backbone:pGEX-6P-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-19 02:09:24 0
SNRPA_Full-length_pGEX
 
Resource Report
Resource Website 		RRID:Addgene_135134 SNRPA Homo sapiens Ampicillin PMID:29883606 Backbone Marker:Promega; Backbone Size:5081; Vector Backbone:pGEX-6P-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-19 02:09:24 0
pCDNA3-Flag MKK6(glu)
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_13518 MKK6(glu) Homo sapiens Ampicillin PMID:8622669 Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pCDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin Ser-207Glu Thr-211Glu 2026-09-19 02:09:25 33
pCDNA3-Flag MKK6
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_13517 MKK6 Homo sapiens Ampicillin PMID:8622669 Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pCDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-09-19 02:09:24 7
RBMS3_2xRRM_pGEX
 
Resource Report
Resource Website 		RRID:Addgene_135142 RBMS3 Homo sapiens Ampicillin PMID:29883606 Backbone Marker:Promega; Backbone Size:5081; Vector Backbone:pGEX-6P-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-19 02:09:24 0
NOVA1_Full-length_pGEX
 
Resource Report
Resource Website 		RRID:Addgene_135147 NOVA1 Homo sapiens Ampicillin PMID:29883606 Backbone Marker:Promega; Backbone Size:5081; Vector Backbone:pGEX-6P-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-19 02:09:24 0
RBM24_RRM_pGEX
 
Resource Report
Resource Website 		RRID:Addgene_135148 RBM24 Homo sapiens Ampicillin PMID:29883606 Backbone Marker:Promega; Backbone Size:5081; Vector Backbone:pGEX-6P-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-19 02:09:24 0
RBM4_2xRRM-ZNF_pGEX
 
Resource Report
Resource Website 		RRID:Addgene_135154 RBM4 Homo sapiens Ampicillin PMID:29883606 Backbone Marker:Promega; Backbone Size:5081; Vector Backbone:pGEX-6P-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-19 02:09:24 0
ILF2_DZF_pGEX
 
Resource Report
Resource Website 		RRID:Addgene_135162 ILF2 Homo sapiens Ampicillin PMID:29883606 Backbone Marker:Promega; Backbone Size:5081; Vector Backbone:pGEX-6P-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-09-19 02:09:24 0
pH9-ilvA-acp (DE2)
 
Resource Report
Resource Website 		RRID:Addgene_135163 ilvA-acp Synthetic Spectinomycin PMID:31395784 Backbone Size:3000; Vector Backbone:pH9; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin 2026-09-19 02:09:24 0
CI-2
 
Resource Report
Resource Website 		RRID:Addgene_135165 CysJ-infA overlapping region in CI-2 Synthetic Spectinomycin PMID:31395784 Backbone Size:3100; Vector Backbone:pH9; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin 2026-09-19 02:09:24 0
CI-3
 
Resource Report
Resource Website 		RRID:Addgene_135166 CysJ-infA overlapping region in CI-3 Synthetic Spectinomycin PMID:31395784 Backbone Size:3100; Vector Backbone:pH9; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin 2026-09-19 02:09:24 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

NIDDK Early Research Partnership Engagement Challenge

Funding Opportunity: National NIH K12 DiabDocs Career Development Program

NIH Data Sharing and Reuse Seminar- Sex Differences in Acute Kidney Injury Risk and Outcomes: Insights from MIMIC-III and MIMIC-IV

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch