Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: CBX1 chromobox protein 1, engineered x3
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:-4; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Defining Citation: PMID:31634430
Proper citation: RRID:Addgene_135090 Copy
Species: Caenorhabditis elegans
Genetic Insert: Pacr-2
Vector Backbone Description: Backbone Marker:Invitrogen Gateway; Backbone Size:4045; Vector Backbone:pDEST; Vector Types:Worm Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20027209
Proper citation: RRID:Addgene_135093 Copy
Species: Homo sapiens
Genetic Insert: NEMO
Vector Backbone Description: Backbone Marker:Made in Guan Lab; Backbone Size:5400; Vector Backbone:pcDNA3-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10358014
Comments: See "Author's Map" for more information.
Proper citation: RRID:Addgene_13512 Copy
Vector Backbone Description: Backbone Size:5288; Vector Backbone:pOO2-GW; Vector Types:bacterial expression vector for generating SP6 transcripts in vitro for Xenopus oocyte transfection; Bacterial Resistance:Chloramphenicol and Ampicillin
Defining Citation: PMID:21107422
Comments: The AtAMT1;1 coding sequence with the att sites (attB1 and attB2) from the pDRf1-AtAMT1;1 (Loque et al 2007 Nature 446 195-198) was remobilized with both restriction enzymes SpeI and XhoI then subsequently cloned between SpeI and XhoI sites in the p6013-002 (Ludewig et al., 2002 J. Biol. Chem. 277, 13548-13555). The AtAMT1;1 coding sequence was then replaced by the Gateway DNA cassette after a BP reaction with pDONR 221 (GATEWAY technology, Invitrogen) to generate the p002-GW vector.
Proper citation: RRID:Addgene_135097 Copy
Species: Homo sapiens
Genetic Insert: BOLL
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5081; Vector Backbone:pGEX-6P-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29883606
Proper citation: RRID:Addgene_135130 Copy
Species: Homo sapiens
Genetic Insert: FKHR H215R AAA
Vector Backbone Description: Backbone Marker:made in Guan Lab; Backbone Size:5000; Vector Backbone:pcDNA3 Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10358014
Comments: See "Author's Map" for map of wild-type pcDNA3-flag-FKHR.
Proper citation: RRID:Addgene_13510 Copy
Species: Synthetic
Genetic Insert: HSV-1 UL23 codon optimized
Vector Backbone Description: Vector Backbone:pcDNA5/FRT/TO/NHASt; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:31653857
Proper citation: RRID:Addgene_135099 Copy
Species: Homo sapiens
Genetic Insert: 3xIRS
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5800; Vector Backbone:pGL2-Promoter; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:10358014
Comments: Two oligonucleotides (GCAAAACAAACTTATTTTGAAGCAAAACAAACTTATTTTGAAGCAAAACAAACTTATTTTGAA and TCGATTCAAAATAAGTTTGTTTTGCTTCAAAATAAGTTTGTTTTGCTTCAAAATAAGTTTGTTTTGCGTAC) were annealed together and ligated into the pGL2-Promoter vector (Promega) to create 3×IRS-luciferase. The IRS sequences were derived from human IGFBP-1's IRS.
See "Author's Map" for more information.
Proper citation: RRID:Addgene_13511 Copy
Species: Homo sapiens
Genetic Insert: RBMS2
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5081; Vector Backbone:pGEX-6P-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29883606
Proper citation: RRID:Addgene_135132 Copy
Species: Homo sapiens
Genetic Insert: SNRPA
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5081; Vector Backbone:pGEX-6P-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29883606
Proper citation: RRID:Addgene_135134 Copy
Species: Homo sapiens
Genetic Insert: MKK6(glu)
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pCDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8622669
Proper citation: RRID:Addgene_13518 Copy
Species: Homo sapiens
Genetic Insert: MKK6
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5446; Vector Backbone:pCDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:8622669
Proper citation: RRID:Addgene_13517 Copy
Species: Homo sapiens
Genetic Insert: RBMS3
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5081; Vector Backbone:pGEX-6P-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29883606
Proper citation: RRID:Addgene_135142 Copy
Species: Homo sapiens
Genetic Insert: NOVA1
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5081; Vector Backbone:pGEX-6P-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29883606
Proper citation: RRID:Addgene_135147 Copy
Species: Homo sapiens
Genetic Insert: RBM24
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5081; Vector Backbone:pGEX-6P-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29883606
Proper citation: RRID:Addgene_135148 Copy
Species: Homo sapiens
Genetic Insert: RBM4
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5081; Vector Backbone:pGEX-6P-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29883606
Proper citation: RRID:Addgene_135154 Copy
Species: Homo sapiens
Genetic Insert: ILF2
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:5081; Vector Backbone:pGEX-6P-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29883606
Proper citation: RRID:Addgene_135162 Copy
Species: Synthetic
Genetic Insert: ilvA-acp
Vector Backbone Description: Backbone Size:3000; Vector Backbone:pH9; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:31395784
Proper citation: RRID:Addgene_135163 Copy
Species: Synthetic
Genetic Insert: CysJ-infA overlapping region in CI-2
Vector Backbone Description: Backbone Size:3100; Vector Backbone:pH9; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:31395784
Proper citation: RRID:Addgene_135165 Copy
Species: Synthetic
Genetic Insert: CysJ-infA overlapping region in CI-3
Vector Backbone Description: Backbone Size:3100; Vector Backbone:pH9; Vector Types:Synthetic Biology; Bacterial Resistance:Spectinomycin
Defining Citation: PMID:31395784
Proper citation: RRID:Addgene_135166 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
