Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
Ec holE-pCDFDuet Resource Report Resource Website |
RRID:Addgene_241264 | holE | E. coli | Streptomycin | Vector Backbone:pCDFDuet; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | 2026-08-15 01:33:43 | 0 | |||
|
Sc hk/P-RFA3-pCDFDuet Resource Report Resource Website 1+ mentions |
RRID:Addgene_240743 | hk/P-RFA3 | Saccharomyces cerevisiae | Streptomycin | Vector Backbone:pCDFDuet; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | 2026-08-15 01:33:42 | 2 | |||
|
pENTR223-ABL2(K281M) Resource Report Resource Website |
RRID:Addgene_215468 | ABL2 | Homo sapiens | Streptomycin | PMID:40419795 | Backbone Marker:Thermo Fisher Scientific Inc.; Backbone Size:4761; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Streptomycin | K281M (kinase-inactivating) | 2026-08-15 01:33:49 | 0 | |
|
pENTR223-ABL2(WT) Resource Report Resource Website |
RRID:Addgene_215467 | ABL2 | Homo sapiens | Streptomycin | PMID:40419795 | Backbone Marker:Invitrogen; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Streptomycin | Includes stop codon | 2026-08-15 01:33:49 | 0 | |
|
Hv_HPT:pCSRM2C:Gus_introns Resource Report Resource Website |
RRID:Addgene_215191 | Scream2 | Other | Streptomycin | PMID:39943924 | Backbone Marker:Sylvestre Marillonnet; Backbone Size:5201; Vector Backbone:pAGM8031; Vector Types:; Bacterial Resistance:Streptomycin | 2026-08-15 01:32:56 | 0 | ||
|
HE_150 Resource Report Resource Website |
RRID:Addgene_201051 | n/a | Streptomycin | This strain has 1059 genetic changes compared to the DH10B reference genome in Genbank (CP000948.1). Please see https://www.ncbi.nlm.nih.gov/nuccore/CP110015 and the accompanying paper for more details. | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Streptomycin | 2026-08-15 01:26:30 | 0 | |||
|
HE_100 Resource Report Resource Website |
RRID:Addgene_201050 | n/a | Streptomycin | This strain has 797 genetic changes compared to the DH10B reference genome in Genbank (CP000948.1). Please see https://www.ncbi.nlm.nih.gov/nuccore/CP110016 and the accompanying paper for more details. | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Streptomycin | 2026-08-15 01:26:30 | 0 | |||
|
pIVM_26 Resource Report Resource Website 1+ mentions |
RRID:Addgene_204501 | EloB (1-104) and EloC (17-112) | Homo sapiens | Streptomycin | PMID:28591624 | Gadd MS, Testa A, Lucas X, Chan KH, Chen W, Lamont DJ, Zengerle M, Ciulli A. Structural basis of PROTAC cooperative recognition for selective protein degradation. Nat Chem Biol. 2017 May;13(5):514-521. doi: 10.1038/nchembio.2329. Epub 2017 Mar 13. PMID: 28288108; PMCID: PMC5392356. | Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDF-1b DUET; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | 0 | 2026-08-15 01:27:44 | 3 |
|
pCDF_TypeIC_target_sfGFP_invivo Resource Report Resource Website |
RRID:Addgene_196399 | type IC dsDNA target | Synthetic | Streptomycin | PMID:36805026 | Vector Backbone:pCDF; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | 2026-08-15 01:27:30 | 0 | ||
|
HB101 endA::frt Resource Report Resource Website |
RRID:Addgene_45473 | endA::frt | Streptomycin | PMID:21306445 | endA was deleted for cleaner and higher yield plasmid preps. | Vector Backbone:N/A; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | major endonuclease endA deleted | 2026-08-15 01:15:24 | 0 | |
|
pTDpelB-CTwinStrep Resource Report Resource Website |
RRID:Addgene_45941 | Streptomycin | PMID:23687945 | This plasmid was tested in the Gram-negative soil bacterium Pseudomonas putida KT2440 and Escherichia coli K12 and is especially suited for protein production, affinity purification, protein complex copurification with SPINE (Strep Protein Interaction Experiments) or (co-)localization studies. Due to the broad host range of the RK2 origin of replication, the plasmid facilitates experimental verification of hypothetical proteins and protein production yield assessment in different expression hosts possibly including new isolates. The Supplementary Table S1 in the following publication lists approximately 30 strains in which the RK2 origin of replication should be functional. Silva-Rocha et al., The Standard European Vector Architecture (SEVA): a coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research 2013, 41:D666-675. http://nar.oxfordjournals.org/content/41/D1/D666.long | Backbone Marker:SEVA (de Lorenzo Lab); Vector Backbone:pSEVA424; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | 2026-08-15 01:15:27 | 0 | |||
|
pTD-C_sfYFPTwinStrep Resource Report Resource Website |
RRID:Addgene_45943 | synthetic sfYFP (codon usage adapted to P.putida KT2440) | Aequorea victoria | Streptomycin | PMID:23687945 | This plasmid was tested in the Gram-negative soil bacterium Pseudomonas putida KT2440 and Escherichia coli K12 and is especially suited for protein production, affinity purification, protein complex copurification with SPINE (Strep Protein Interaction Experiments) or (co-)localization studies. Due to the broad host range of the RK2 origin of replication, the plasmid facilitates experimental verification of hypothetical proteins and protein production yield assessment in different expression hosts possibly including new isolates. The Supplementary Table S1 in the following publication lists approximately 30 strains in which the RK2 origin of replication should be functional. Silva-Rocha et al., The Standard European Vector Architecture (SEVA): a coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research 2013, 41:D666-675. http://nar.oxfordjournals.org/content/41/D1/D666.long | Backbone Marker:Dammeyer et al. 2013; Vector Backbone:pTD-CTwinStrep; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | 2026-08-15 01:15:27 | 0 | |
|
pTD-C_eYFPTwinStrep Resource Report Resource Website |
RRID:Addgene_45942 | synthetic eYFP (codon usage adapted to E.coli K12) | Aequorea victoria | Streptomycin | PMID:23687945 | This plasmid was tested in the Gram-negative soil bacterium Pseudomonas putida KT2440 and Escherichia coli K12 and is especially suited for protein production, affinity purification, protein complex copurification with SPINE (Strep Protein Interaction Experiments) or (co-)localization studies. Due to the broad host range of the RK2 origin of replication, the plasmid facilitates experimental verification of hypothetical proteins and protein production yield assessment in different expression hosts possibly including new isolates. The Supplementary Table S1 in the following publication lists approximately 30 strains in which the RK2 origin of replication should be functional. Silva-Rocha et al., The Standard European Vector Architecture (SEVA): a coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research 2013, 41:D666-675. http://nar.oxfordjournals.org/content/41/D1/D666.long | Backbone Marker:Dammeyer et al. 2013; Vector Backbone:pTD-CTwinStrep; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | 2026-08-15 01:15:27 | 0 | |
|
pAF-HdrB3 Resource Report Resource Website |
RRID:Addgene_184908 | Cas9-sgRNA-homology arms | Synthetic | Streptomycin | PMID:37556825 | Please visit https://www.biorxiv.org/content/10.1101/2022.03.14.484339v1 for bioRxiv preprint. | Vector Backbone:pJRD215; Vector Types:Bacterial Expression, CRISPR, broad-host-range; Bacterial Resistance:Streptomycin | 2026-08-15 01:23:41 | 0 | |
|
pREDawn-StrR-MCS Resource Report Resource Website |
RRID:Addgene_188979 | Streptomycin | PMID:35998606 | Please note that Addgene's NGS found a 65bp insertion in the ori region as compared to the Depositor's sequence. The depositor has confirmed that the plasmid functions as described in the associated publication. | Vector Backbone:pUC; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | 2026-08-15 01:23:47 | 0 | |||
|
pYI048 Resource Report Resource Website |
RRID:Addgene_170844 | pGH3.17::SMT2-FLAG | Streptomycin | PMID:36216814 | Please visit https://doi.org/10.1101/2021.06.16.448628 for bioRxiv preprint. | Vector Backbone:pYI001; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin | 2026-08-15 01:23:57 | 0 | ||
|
pYI046 Resource Report Resource Website |
RRID:Addgene_170842 | pUBQ10::SMT2-FLAG::tOCS | Streptomycin | PMID:36216814 | Please visit https://doi.org/10.1101/2021.06.16.448628 for bioRxiv preprint. | Vector Backbone:pFP100; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin | 2026-08-15 01:23:57 | 0 | ||
|
pYI047 Resource Report Resource Website |
RRID:Addgene_170843 | pFRO6::SMT2-FLAG | Streptomycin | PMID:36216814 | Please note that the Addgene verified sequence differs from the depositor reference sequence linked in the supplemental documents section. These differences did not impact plasmid function. The primers 5' - ATCCAAGCTCAAGCTAAGCTcgatgctctcaaggccaa and 3' -TATCTCATTAAAGCAGGATCCTCACTTGTCATCGTCGTCCTTGTAATCAGAACTCTCCTCCGGT were previously used, although the 5' primer differs slightly from the Addgene verified sequence. Please visit https://doi.org/10.1101/2021.06.16.448628 for bioRxiv preprint. | Vector Backbone:pYI001; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin | 2026-08-15 01:24:00 | 0 | ||
|
pYI012 Resource Report Resource Website |
RRID:Addgene_170841 | GH3.17p | Streptomycin | PMID:36216814 | Please visit https://doi.org/10.1101/2021.06.16.448628 for bioRxiv preprint. | Vector Backbone:pYI001; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin | 2026-08-15 01:23:57 | 0 | ||
|
NCH1exp Resource Report Resource Website |
RRID:Addgene_131017 | NCH1 | Zea mays (maize) | Streptomycin | PMID:33679862 | Backbone Size:11546; Vector Backbone:pH7WG2; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin | 2026-08-15 01:22:54 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
