Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Genetic Insert: Recoded E. coli strain without TCG, TCA, or TAG codons
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:31092918
Comments: The compressed genome of Syn61 was designed by systematically replacing the TCG, TCA, and TAG codons with their synonyms AGC, AGT, and TAA, respectively, in all open reading frames.
Genotyping primers for presence of synthetic insert in 100k01 in Syn61 strain:
GE282 AAAAAGGTCGGGCCGGACGGTC
GE283 GCAATAATGGCAGCCACACCTTG
Proper citation: RRID:Addgene_174513 Copy
Genetic Insert: Recoded E. coli strain without TCG, TCA, or TAG codons in the open reading frames and deleted serT, serU and prfA genes
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:34083482
Comments: From the Syn61 strain (Addgene #174513), two rounds of parallel mutagenesis and dynamic selection were followed by deletion of the serT, serU and prfA genes, and a further three rounds of parallel mutagenesis and dynamic selection yielded Syn61Δ3(ev5) (Addgene #174514).
Genotyping primers for presence of synthetic insert in 100k01 in Syn61 strain:
GE282 AAAAAGGTCGGGCCGGACGGTC
GE283 GCAATAATGGCAGCCACACCTTG
Genotyping for deletion of serU gene:
GE1147 TACGAATGATGCCTCGCCGCAAATAAG
GE1148 CCTCACGCAACGGAATAAAGGGAACTC
Genotyping for deletion of serT gene:
GE1215 AGCGTCAGGCTCAGCAGAAAATAGG
GE1216 ACGTCCCTGTAGCAAGGCAAACCATC
Genotyping for deletion of prfA gene:
v13-1011 GACTAACCGCTTGATCCATGCGC
v13-1012 CAAGTTGCTGACATTGTTCGTCAGTCAGC
Proper citation: RRID:Addgene_174514 Copy
Species: E. coli
Genetic Insert: BJ5183 bacterial cells
Vector Backbone Description: Backbone Size:0; Vector Backbone:n/a; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:9482916
Comments: This is a bacterial strain - not a plasmid. Select with 30 ug/mL streptomycin.
Electrocompetent BJ5183 cells are used to carry out the recombination between the shuttle vector (pShuttle, pShuttle-CMV, pAdTrack, or pAdTrack-CMV) and the adenoviral vector (pAdEasy1 or pAdEasy2).
Proper citation: RRID:Addgene_16398 Copy
Species: Synthetic
Genetic Insert: Zea mays FNR and Z. mays SIR
Vector Backbone Description: Vector Backbone:P15a; Vector Types:Synthetic Biology; Bacterial Resistance:Streptomycin
Comments: For detailed annotations see the GenBank file under Resource Information/Supplemental Documents. Please visit https://www.biorxiv.org/content/10.1101/645978v1 for BioRxiv preprint
Proper citation: RRID:Addgene_131805 Copy
Species: Arabidopsis thaliana
Genetic Insert: PhyB(1-651)-AviTag-His6
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:33659515
Proper citation: RRID:Addgene_131864 Copy
Species: Arabidopsis thaliana
Genetic Insert: PhyB(1-651)-RGD-His6-Cys
Vector Backbone Description: Backbone Marker:Novagen; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:31526004
Proper citation: RRID:Addgene_131862 Copy
Species: Synthetic
Genetic Insert: PluxB_ToeRep_N01_trigger
Vector Backbone Description: Backbone Size:3235; Vector Backbone:pCDFduet; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:31686032
Comments: Please visit https://www.biorxiv.org/content/10.1101/501783v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_132736 Copy
Species: Pseudomonas aeruginosa SG17M
Genetic Insert: disaggregase ClpGgi with 6xHis-tag
Vector Backbone Description: Backbone Size:6055; Vector Backbone:pJN105; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:29263094
Comments: conditional Biosafety Level 2 if expressed in Pseudomonas aeruginosa SG17M
Proper citation: RRID:Addgene_126503 Copy
Species: Zea mays
Genetic Insert: Zea mays Ferredoxin-NADP reductase
Vector Backbone Description: Vector Backbone:p15a; Vector Types:Synthetic Biology; Bacterial Resistance:Streptomycin
Defining Citation: PMID:32434930
Proper citation: RRID:Addgene_137965 Copy
Species: Zea mays
Genetic Insert: Zea mays Ferredoxin-NADP reductase
Vector Backbone Description: Vector Backbone:p15a; Vector Types:Synthetic Biology; Bacterial Resistance:Streptomycin
Defining Citation: PMID:32434930
Proper citation: RRID:Addgene_137966 Copy
Species: Phaeodactylum tricornutum
Genetic Insert: Phaeodactylum U6 promoter
Vector Backbone Description: Backbone Size:2817; Vector Backbone:pCR8/GW/TOPO; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:34566902
Comments: For Golden Gated assembly.
Please visit https://www.biorxiv.org/content/early/2018/10/17/444109 for bioRxiv preprint.
Proper citation: RRID:Addgene_104895 Copy
Species: Homo sapiens
Genetic Insert: huH3
Vector Backbone Description: Vector Backbone:pCDF; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:41123210
Proper citation: RRID:Addgene_197272 Copy
Species: Homo sapiens
Genetic Insert: ABL2
Vector Backbone Description: Backbone Marker:Thermo Fisher Scientific Inc.; Backbone Size:4761; Vector Backbone:pDONR221; Vector Types:Gateway Cloning; Bacterial Resistance:Streptomycin
Defining Citation: PMID:40419795
Proper citation: RRID:Addgene_215468 Copy
Species: Homo sapiens
Genetic Insert: ABL2
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pDONR223; Vector Types:Gateway Cloning; Bacterial Resistance:Streptomycin
Defining Citation: PMID:40419795
Proper citation: RRID:Addgene_215467 Copy
Species: Escherichia coli
Genetic Insert: phosphoglycerate kinase
Vector Backbone Description: Backbone Size:3810; Vector Backbone:pCDM4; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:23361000
Proper citation: RRID:Addgene_49808 Copy
Species: Homo sapiens
Genetic Insert: SUMO-2
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:25007328
Proper citation: RRID:Addgene_52259 Copy
Species: Homo sapiens
Genetic Insert: SUMO-3
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:25007328
Proper citation: RRID:Addgene_52260 Copy
Species: Homo sapiens
Genetic Insert: SUMO-2
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Defining Citation: PMID:25007328
Proper citation: RRID:Addgene_52262 Copy
Species: Other
Genetic Insert: Scream2
Vector Backbone Description: Backbone Marker:Sylvestre Marillonnet; Backbone Size:5201; Vector Backbone:pAGM8031; Vector Types:; Bacterial Resistance:Streptomycin
Defining Citation: PMID:39943924
Proper citation: RRID:Addgene_215191 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: RFC5
Vector Backbone Description: Vector Backbone:pCDFDuet; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
Proper citation: RRID:Addgene_239202 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
