Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Vector Backbone Description: Backbone Size:3506; Vector Backbone:pSLfa; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_52908 Copy
Species: Drosophila pseudoobscura
Genetic Insert: Drosophila pseudoobscura hsp82 promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4786; Vector Backbone:pGL3; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23549343
Proper citation: RRID:Addgene_52909 Copy
Species: Deinococcus radiodurans
Genetic Insert: Zipp.-L-IFP-F[2]+Venus
Vector Backbone Description: Backbone Marker:Addgene; Vector Backbone:pLpC; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24747815
Proper citation: RRID:Addgene_52906 Copy
Species: Deinococcus radiodurans
Genetic Insert: Zipp.-L-IFP-F[1]+Plum
Vector Backbone Description: Backbone Marker:Addgene; Vector Backbone:pLpC; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24747815
Proper citation: RRID:Addgene_52907 Copy
Vector Backbone Description: Backbone Size:5935; Vector Backbone:pMos3xP3DsRED; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20456509
Comments: attP site is gtagtgccccaactggggtaacctttgagttctctcagttgggggcgtag
Proper citation: RRID:Addgene_52904 Copy
Species: Homo sapiens
Genetic Insert: Cat-L-IFP-F[1]+Plum
Vector Backbone Description: Backbone Marker:Addgene; Vector Backbone:pLpC; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24747815
Proper citation: RRID:Addgene_52905 Copy
Species: E.coli
Genetic Insert: RhyB sRNA
Vector Backbone Description: Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21189298
Proper citation: RRID:Addgene_52993 Copy
Species: E.coli
Genetic Insert: OxyS sRNA
Vector Backbone Description: Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21189298
Comments: The pLlacO-1 promoter is induced by adding isopropyl-β-d-thiogalactopyranoside (IPTG) to the media. The LtetO-1 promoter is constitutively transcribed without TetR in the system. The part of the target mRNA that is necessary for sRNA regulation was fused to gfp or mCherry.
Proper citation: RRID:Addgene_52991 Copy
Species: E.coli
Genetic Insert: DsrA sRNA
Vector Backbone Description: Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21189298
Proper citation: RRID:Addgene_52992 Copy
Species: E.coli
Genetic Insert: MicC sRNA
Vector Backbone Description: Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21189298
Comments: The pLlacO-1 promoter is induced by adding isopropyl-β-d-thiogalactopyranoside (IPTG) to the media. The LtetO-1 promoter is constitutively transcribed without TetR in the system. The part of the target mRNA that is necessary for sRNA regulation was fused to gfp or mCherry.
Proper citation: RRID:Addgene_52990 Copy
Species: Homo sapiens
Genetic Insert: HAS6
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21734034
Proper citation: RRID:Addgene_52913 Copy
Species: Chlamydomonas
Genetic Insert: Channelrhodopsin-2
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:5420; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24674867
Proper citation: RRID:Addgene_52878 Copy
Species: E. coli
Genetic Insert: RhyB sRNA
Vector Backbone Description: Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21189298
Proper citation: RRID:Addgene_52999 Copy
Species: Aedes aegypti
Genetic Insert: Aa Hsp70B-1696
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4773; Vector Backbone:pGL3; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19496419
Proper citation: RRID:Addgene_52912 Copy
Genetic Insert: Luciferase duplication-TALEN recognition sites
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:6460; Vector Backbone:pGL3; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
Defining Citation: PMID:23555893
Proper citation: RRID:Addgene_52910 Copy
Species: E.coli
Genetic Insert: RhyB sRNA
Vector Backbone Description: Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21189298
Proper citation: RRID:Addgene_52995 Copy
Species: Homo sapiens
Genetic Insert: IFIH1
Vector Backbone Description: Backbone Size:5500; Vector Backbone:pEF-Bos-Flag; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:19211564
Proper citation: RRID:Addgene_52875 Copy
Species: E.coli
Genetic Insert: RhyB sRNA
Vector Backbone Description: Backbone Marker:Lim lab; Vector Backbone:unknown; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21189298
Proper citation: RRID:Addgene_52996 Copy
Species: Japanese encephalitis virus
Genetic Insert: prME
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5428; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:24039574
Comments: JEV CH2195
The sequence in this plasmid corresponds to the prM and E genes of Japanese encephalitis virus strain CH2195LA. The reference sequence for this isolate of the virus is GenBank AF221499.1
Proper citation: RRID:Addgene_52881 Copy
Species: west nile virus
Genetic Insert: prM-E
Vector Backbone Description: Vector Backbone:pPSClo; Vector Types:Unspecified; Bacterial Resistance:Ampicillin
Proper citation: RRID:Addgene_52882 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
