Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Preparing word cloud

×

Norway

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:synthetic (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

30,397 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pFAB1902
 
Resource Report
Resource Website 		RRID:Addgene_47858 M13_central_T_linker_rrnD_T1 double terminator Synthetic Kanamycin PMID:23474465 Terminator efficiency measured at 100% (97% and 99% alone, respectively). Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired. Backbone Size:3967; Vector Backbone:pFAB775; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin concatenate of M13 central and rrnD 2026-08-15 01:15:45 0
pFAB816
 
Resource Report
Resource Website 		RRID:Addgene_47851 ilvGEDA Synthetic Kanamycin PMID:23474465 Terminator efficiency measured at 99%. Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired. Backbone Size:3967; Vector Backbone:pFAB768; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:15:46 0
pFAB1907
 
Resource Report
Resource Website 		RRID:Addgene_47857 BBa_B1006 U10 Synthetic Kanamycin PMID:23474465 Terminator efficiency measured at 99%. Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired. Backbone Size:3967; Vector Backbone:pFAB774; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin Added two extra U at the end of Bba_1006 poly-U tail 2026-08-15 01:15:46 0
pTrex-Neo-tdTomato
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_47975 tdTomato Synthetic Ampicillin PMID:20644616 Shaner NC, Campbell RE, Steinbach PA, Giepmans BN, Palmer AE, Tsien RY. Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nat Biotechnol. 2004;22:1567–1572 Vazquez MP, Levin MJ (1999) Functional analysis of the intergenic regions of TcP2beta gene loci allowed the construction of an improved Trypanosoma cruzi expression vector. Gene 239: 217–225. doi: 10.1016/S0378-1119(99)00386-8. Backbone Marker:Martin P. Vazquez; Backbone Size:6200; Vector Backbone:pTrex-Neo; Vector Types:Trypanasoma cruzi expression; Bacterial Resistance:Ampicillin 2026-08-15 01:15:47 3
pFAB820
 
Resource Report
Resource Website 		RRID:Addgene_47855 tetAC terminator Synthetic Kanamycin PMID:23474465 Terminator efficiency measured at 50%. Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired. Backbone Size:3967; Vector Backbone:pFAB772; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:15:45 0
pFAB806
 
Resource Report
Resource Website 		RRID:Addgene_47849 lambda tR2 terminator Synthetic Kanamycin PMID:23474465 Terminator efficiency measured at 91%. Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired. Backbone Size:3967; Vector Backbone:pFAB766; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:15:45 0
pFAB803
 
Resource Report
Resource Website 		RRID:Addgene_47847 T7 early terminator Synthetic Kanamycin PMID:23474465 Terminator efficiency measured at 96%. Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired. Backbone Size:3967; Vector Backbone:pFAB764; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:15:45 0
pFAB804
 
Resource Report
Resource Website 		RRID:Addgene_47848 T3 early terminator Synthetic Kanamycin PMID:23474465 Terminator efficiency measured at 94%. Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired. Backbone Size:3967; Vector Backbone:pFAB765; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:15:46 0
pFAB3893
 
Resource Report
Resource Website 		RRID:Addgene_47844 promoter 13 and BCD1 Synthetic Kanamycin PMID:23474465 http://biofab.org/services RFP fluorescence (Arbitrary Units, AU) is used to measure the efficiency of the promoter/BCD combination. Promoter/BCD combinations ranged from a low score of 6.14 to a high score of 634.54. The score for this combination was: 48.98 Backbone Size:3000; Vector Backbone:pFAB1781; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Kanamycin 2026-08-15 01:15:46 0
SuperNova/pRSETB
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_53234 monomeric photosensitizing fluorescent protein for chromophore-assisted light inactivation Synthetic Ampicillin PMID:24043132 Backbone Marker:Invitrogen; Backbone Size:2900; Vector Backbone:pRSET-B; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:16:29 4
pZS*11-yfp0
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_53241 YFP Synthetic Ampicillin PMID:23277573 Backbone Marker:Lutz and Bujard 1997; Backbone Size:4000; Vector Backbone:pzs*11; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:16:29 3
pET16b-alpha3D
 
Resource Report
Resource Website 		RRID:Addgene_53310 alpha3D Synthetic Ampicillin PMID:10318910 Backbone Marker:Novagen; Backbone Size:5711; Vector Backbone:pET16b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:16:29 0
pEGFP-C1+SKL
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_53450 SKL amino acids Synthetic Kanamycin PMID:21132080 Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2026-08-15 01:16:33 3
pMPRA2-CMV-Clover
 
Resource Report
Resource Website 		RRID:Addgene_53539 Clover GFP Synthetic Ampicillin PMID:25177895 Backbone Marker:Broad Institute; Vector Backbone:pMPRA2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:16:33 0
pMPRA3-CMV-Clover
 
Resource Report
Resource Website 		RRID:Addgene_53540 Clover GFP Synthetic Ampicillin PMID:25177895 Addgene sequencing detected an IS1 transposable element Backbone Marker:Broad Institute; Vector Backbone:pMPRA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:16:31 0
Nano-lantern(cAMP-1.6)/pRSETB
 
Resource Report
Resource Website 		RRID:Addgene_53591 Nano-lantern-based luminescent cAMP indicator Synthetic Ampicillin PMID:23232392 Backbone Marker:Invitrogen; Backbone Size:2900; Vector Backbone:pRSETB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:16:32 0
Nano-lantern(cAMP-1.6)/pcDNA3
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_53594 Nano-lantern-based luminescent cAMP indicator Synthetic Ampicillin PMID:23232392 Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:16:32 3
Nano-lantern(cAMP-3.3)/pcDNA3
 
Resource Report
Resource Website 		RRID:Addgene_53595 Nano-lantern-based luminescent cAMP indicator Synthetic Ampicillin PMID:23232392 Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:16:32 0
Nano-lantern(cAMP-3.3)/pRSETB
 
Resource Report
Resource Website 		RRID:Addgene_53592 Nano-lantern-based luminescent cAMP indicator Synthetic Ampicillin PMID:23232392 Backbone Marker:Invitrogen; Backbone Size:2900; Vector Backbone:pRSETB; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2026-08-15 01:16:32 0
LI dy C-D
 
Resource Report
Resource Website 		RRID:Addgene_54343 C-D dummy Synthetic Gentamicin PMID:24551083 L1 dummy. Backbone Marker:Parniske lab; Vector Backbone:pUC57 (Gent); Vector Types:cloning vector; Bacterial Resistance:Gentamicin 2026-08-15 01:16:39 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.

Recent News Entries

Join the Whole Person Physiome 1st Data Jamboree on August 24-25

Join Dr. Chen Li for a Knowledge Portal Network Webinar on the dkNET Computational Core on August 6

Join NIH ODSS Data Sharing and Reuse Seminar "PanKbase: An Open, FAIR Knowledge Base of the Human Pancreas to Accelerate Diabetes Research"

Contact Us

Email: info_at_ dknet.org

Stay Connected

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch