Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pYES2.1-cerMET14 Resource Report Resource Website |
RRID:Addgene_107441 | MET14 | Saccharomyces cerevisiae | Ampicillin | PMID:29326101 | contains the coding sequence for adenylylsulfate kinase | Backbone Marker:Invitrogen; Backbone Size:5886; Vector Backbone:pYES2.1; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:01:10 | 0 | |
|
pYES2.1-cerMET10 Resource Report Resource Website |
RRID:Addgene_107440 | MET10 | Saccharomyces cerevisiae | Ampicillin | PMID:29326101 | contains the coding sequence for the alpha subunit of sulfite reductase | Backbone Marker:Invitrogen; Backbone Size:5886; Vector Backbone:pYES2.1; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:01:10 | 0 | |
|
pROS17 Resource Report Resource Website 1+ mentions |
RRID:Addgene_107931 | gRNA-CAN1.Y, gRNA-ADE2.Y | Saccharomyces cerevisiae | Ampicillin | PMID:25743786 | Backbone Marker:George Church (Addgene plasmid # 43803); Backbone Size:5280; Vector Backbone:p426-SNR52p-gRNA.CAN1.Y-SUP4t; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:01:15 | 1 | ||
|
pROS15 Resource Report Resource Website 1+ mentions |
RRID:Addgene_107929 | gRNA-CAN1.Y, gRNA-ADE2.Y | Saccharomyces cerevisiae | Ampicillin | PMID:25743786 | Backbone Marker:George Church (Addgene plasmid # 43803); Backbone Size:5660; Vector Backbone:p426-SNR52p-gRNA.CAN1.Y-SUP4t; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:01:15 | 1 | ||
|
pROS13 Resource Report Resource Website 1+ mentions |
RRID:Addgene_107927 | gRNA-CAN1.Y, gRNA-ADE2.Y | Saccharomyces cerevisiae | Ampicillin | PMID:25743786 | Backbone Marker:George Church (Addgene plasmid # 43803); Backbone Size:5817; Vector Backbone:p426-SNR52p-gRNA.CAN1.Y-SUP4t; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:01:15 | 1 | ||
|
pROS10 Resource Report Resource Website 1+ mentions |
RRID:Addgene_107924 | gRNA-CAN1.Y, gRNA-ADE2.Y | Saccharomyces cerevisiae | Ampicillin | PMID:25743786 | Backbone Marker:George Church (Addgene plasmid # 43803); Backbone Size:5577; Vector Backbone:p426-SNR52p-gRNA.CAN1.Y-SUP4t; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:01:15 | 1 | ||
|
pMEL17 Resource Report Resource Website 1+ mentions |
RRID:Addgene_107923 | gRNA-CAN1.Y | Saccharomyces cerevisiae | Ampicillin | PMID:25743786 | Backbone Marker:George Church (Addgene plasmid # 43803); Backbone Size:5593; Vector Backbone:p426-SNR52p-gRNA.CAN1.Y-SUP4t; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:01:15 | 1 | ||
|
pMEL16 Resource Report Resource Website 1+ mentions |
RRID:Addgene_107922 | gRNA-CAN1.Y | Saccharomyces cerevisiae | Ampicillin | PMID:25743786 | Backbone Marker:George Church (Addgene plasmid # 43803); Backbone Size:5775; Vector Backbone:p426-SNR52p-gRNA.CAN1.Y-SUP4t; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin | 2026-08-15 01:01:15 | 3 | ||
|
pBV163 Resource Report Resource Website |
RRID:Addgene_108364 | Knock-in Cg TDH3 promoter in Cg YAP1 gene | Saccharomyces cerevisiae | Ampicillin | PMID:29600281 | Backbone Size:2648; Vector Backbone:pFA6a; Vector Types:Replace C.glabrata YAP1 promoter with C. glabrata TDH3 promoter; Bacterial Resistance:Ampicillin | 2026-08-15 01:01:19 | 0 | ||
|
pCAGGS-6011nes Resource Report Resource Website 1+ mentions |
RRID:Addgene_108652 | hyBRET-ERK-EV | Saccharomyces cerevisiae | Ampicillin | PMID:29895862 | Backbone Size:4739; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:01:21 | 3 | ||
|
pJCSUP35 Resource Report Resource Website |
RRID:Addgene_1088 | SUP35 | Saccharomyces cerevisiae | Ampicillin | PMID:9182769 | Backbone Marker:J. Clos and Brandau, 1994; Backbone Size:0; Vector Backbone:pJC45; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:01:23 | 0 | ||
|
pRRP51A+intron-LacZ (pHZ18) Resource Report Resource Website |
RRID:Addgene_33131 | RP51A+intron-LacZ | Saccharomyces cerevisiae | Ampicillin | PMID:6308621 | GAL-UAS-CYC1-TATA-C7C1-ATG-RP51A+intron-LacZ | Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:52 | 0 | |
|
pLG-Sty Resource Report Resource Website |
RRID:Addgene_33149 | RP51A-synthetic minimal intron | Saccharomyces cerevisiae | Ampicillin | PMID:2655924 | Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG | Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | Sty1 site upstream of intron was cut/filled/ligated to change CCATGG to CCATGCATGG | 2026-08-15 01:13:47 | 0 |
|
pLG-Acc Resource Report Resource Website |
RRID:Addgene_33148 | RP51A-synthetic minimal intron | Saccharomyces cerevisiae | Ampicillin | PMID:2655924 | Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG | Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | AccI site in intron was cut/filled/ligated to change GTCGAC to GTCGCGAC | 2026-08-15 01:13:47 | 0 |
|
Gal-Rad51 KR Resource Report Resource Website |
RRID:Addgene_33232 | Rad51 | Saccharomyces cerevisiae | Ampicillin | PMID:20864034 | Backbone Size:5857; Vector Backbone:pYES2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | K191R | 2026-08-15 01:13:47 | 0 | |
|
Gal-Rad51 Resource Report Resource Website |
RRID:Addgene_33230 | Rad51 | Saccharomyces cerevisiae | Ampicillin | PMID:20864034 | Backbone Size:5857; Vector Backbone:pYES2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:47 | 0 | ||
|
pLG-Nde-Acc Resource Report Resource Website |
RRID:Addgene_33150 | RP51A-synthetic minimal intron | Saccharomyces cerevisiae | Ampicillin | PMID:2655924 | Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG | Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | AccI site in intron was cut/filled/ligated to change GTCGAC to GTCGCGAC, and NdeI site after intron was cut/filled and a BamHI linker was inserted to obtain the appropriate reading frame changing CATATG to CATACGGGATCC | 2026-08-15 01:13:53 | 0 |
|
pLG-deltaA Resource Report Resource Website |
RRID:Addgene_33151 | RP51A-synthetic minimal intron | Saccharomyces cerevisiae | Ampicillin | PMID:2655924 | Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG Modified intron sequence: GACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG | Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | The RP51A sequence was modified by digestion with StyI and HincII, filled in and ligated to delete ~27bp including the 5' splice site | 2026-08-15 01:13:47 | 0 |
|
P413TEF-PYK1 Resource Report Resource Website |
RRID:Addgene_34605 | PYK1 | Saccharomyces cerevisiae | Ampicillin | PMID:21907146 | Backbone Marker:ATCC#87362 (PMID:7737504); Backbone Size:5557; Vector Backbone:P413TEF; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:13:53 | 0 | ||
|
p416GPD-PYK1 Resource Report Resource Website |
RRID:Addgene_34604 | PYK1 | Saccharomyces cerevisiae | Ampicillin | PMID:21907146 | Backbone Marker:ATCC#87360 (PMID: 7737504; Backbone Size:5739; Vector Backbone:p416GPD; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2026-08-15 01:14:01 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.