Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: ORF2 derived from mouse LINE1
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pZeoSV2(+); Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:33938150
Proper citation: RRID:Addgene_206026 Copy
Species: Synthetic
Genetic Insert: Defective hygromycin resistant gene
Vector Backbone Description: Backbone Marker:Dirk Schnappinger; Backbone Size:3592; Vector Backbone:pDE43-MCZ; Vector Types:Bacterial Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:34235660
Comments: Defective hygromycin-resistant gene was generated by overlap PCR and cloned into the PvuI-HindIII sites of pDE43-MCZ, a mycobacterial phage L5 integrating vector.
Proper citation: RRID:Addgene_210788 Copy
Species: Other
Genetic Insert: VenusYFP
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pDONR/Zeo; Vector Types:Gateway Cloning; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:26644504
Proper citation: RRID:Addgene_71265 Copy
Vector Backbone Description: Backbone Marker:Life Technologies; Backbone Size:4871; Vector Backbone:pPICZalpha C; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:23410102
Comments: C-terminal tags are separated by stop codons. Depending on the LP2 primer used in SLIC, the desired C-terminal tag(s) can be fused to the target gene.
Use the one of the following linearization primers pairs for SLIC cloning. Choose one LP1 forward vector primer and one LP2 reverse vector primer:
LP1 forward vector primer:
SLIC Primer (3C site) 5' GGGCCCCTGGAACAGAACTTCCAG 3'
LP2 - select an LP2 primer below depending on which C-terminal tags you want to include fused to your gene of interest:
none SLIC Primer 5' CGCCATTAACCTGATGTTCTGGGG 3'
10His- SLIC Primer 5`GAGCATCATCATCATCACCAC 3'
StrepOne - SLIC Primer 5`AGCGCTTGGAGCCACCCGCAG 3'
S-Tag - SLIC Primer 5`AAAGAAACCGCTGCTGCTAAATTCG 3'
HPC4 - SLIC Primer 5`GAGGACCAGGTGGACCCCCGG 3'
Æ54CPD - SLIC Primer 5`GGCAGCGGCAAGATCCTGCAC 3'
Test each preparation of the plasmid by transforming it into non-resistant cells (ex. DH5a) to ensure negative selection by ccdB kills all the transformed cells as expected.
Proper citation: RRID:Addgene_55190 Copy
Species: Mus musculus
Genetic Insert: immunoglobulin heavy constant mu
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29323348
Proper citation: RRID:Addgene_91729 Copy
Species: Mus musculus
Genetic Insert: immunoglobulin heavy constant mu
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29323348
Proper citation: RRID:Addgene_91747 Copy
Species: Mus musculus
Genetic Insert: immunoglobulin heavy constant mu
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29323348
Proper citation: RRID:Addgene_91748 Copy
Species: Mus musculus
Genetic Insert: immunoglobulin heavy constant mu
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29323348
Proper citation: RRID:Addgene_91745 Copy
Species: Mus musculus
Genetic Insert: immunoglobulin heavy constant mu
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29323348
Proper citation: RRID:Addgene_91746 Copy
Species: Mus musculus
Genetic Insert: immunoglobulin heavy constant mu
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29323348
Proper citation: RRID:Addgene_91744 Copy
Species: Mus musculus
Genetic Insert: immunoglobulin heavy constant mu
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29323348
Proper citation: RRID:Addgene_91740 Copy
Species: Mus musculus
Genetic Insert: immunoglobulin heavy constant mu
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29323348
Proper citation: RRID:Addgene_91738 Copy
Species: Mus musculus
Genetic Insert: immunoglobulin heavy constant mu
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29323348
Proper citation: RRID:Addgene_91734 Copy
Species: Mus musculus
Genetic Insert: immunoglobulin heavy constant mu
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29323348
Proper citation: RRID:Addgene_91735 Copy
Species: Mus musculus
Genetic Insert: immunoglobulin heavy constant mu
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29323348
Proper citation: RRID:Addgene_91732 Copy
Species: Mus musculus
Genetic Insert: immunoglobulin heavy constant mu
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29323348
Proper citation: RRID:Addgene_91730 Copy
Species: Mus musculus
Genetic Insert: immunoglobulin heavy constant mu
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29323348
Proper citation: RRID:Addgene_91754 Copy
Species: Mus musculus
Genetic Insert: immunoglobulin heavy constant mu
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29323348
Proper citation: RRID:Addgene_91752 Copy
Species: Mus musculus
Genetic Insert: immunoglobulin heavy constant mu
Vector Backbone Description: Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:29323348
Proper citation: RRID:Addgene_91750 Copy
Genetic Insert: Cas9
Vector Backbone Description: Vector Backbone:pMAZ-SK; Vector Types:CRISPR; Bacterial Resistance:Bleocin (Zeocin)
Defining Citation: PMID:28764701
Proper citation: RRID:Addgene_92053 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
