Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 10 showing 181 ~ 200 out of 4,486 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_107441

http://www.addgene.org/107441

Species: Saccharomyces cerevisiae
Genetic Insert: MET14
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5886; Vector Backbone:pYES2.1; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29326101
Comments: contains the coding sequence for adenylylsulfate kinase

Proper citation: RRID:Addgene_107441 Copy   


  • RRID:Addgene_107440

http://www.addgene.org/107440

Species: Saccharomyces cerevisiae
Genetic Insert: MET10
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5886; Vector Backbone:pYES2.1; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29326101
Comments: contains the coding sequence for the alpha subunit of sulfite reductase

Proper citation: RRID:Addgene_107440 Copy   


  • RRID:Addgene_107931

    This resource has 1+ mentions.

http://www.addgene.org/107931

Species: Saccharomyces cerevisiae
Genetic Insert: gRNA-CAN1.Y, gRNA-ADE2.Y
Vector Backbone Description: Backbone Marker:George Church (Addgene plasmid # 43803); Backbone Size:5280; Vector Backbone:p426-SNR52p-gRNA.CAN1.Y-SUP4t; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25743786

Proper citation: RRID:Addgene_107931 Copy   


  • RRID:Addgene_107929

    This resource has 1+ mentions.

http://www.addgene.org/107929

Species: Saccharomyces cerevisiae
Genetic Insert: gRNA-CAN1.Y, gRNA-ADE2.Y
Vector Backbone Description: Backbone Marker:George Church (Addgene plasmid # 43803); Backbone Size:5660; Vector Backbone:p426-SNR52p-gRNA.CAN1.Y-SUP4t; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25743786

Proper citation: RRID:Addgene_107929 Copy   


  • RRID:Addgene_107927

    This resource has 1+ mentions.

http://www.addgene.org/107927

Species: Saccharomyces cerevisiae
Genetic Insert: gRNA-CAN1.Y, gRNA-ADE2.Y
Vector Backbone Description: Backbone Marker:George Church (Addgene plasmid # 43803); Backbone Size:5817; Vector Backbone:p426-SNR52p-gRNA.CAN1.Y-SUP4t; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25743786

Proper citation: RRID:Addgene_107927 Copy   


  • RRID:Addgene_107924

    This resource has 1+ mentions.

http://www.addgene.org/107924

Species: Saccharomyces cerevisiae
Genetic Insert: gRNA-CAN1.Y, gRNA-ADE2.Y
Vector Backbone Description: Backbone Marker:George Church (Addgene plasmid # 43803); Backbone Size:5577; Vector Backbone:p426-SNR52p-gRNA.CAN1.Y-SUP4t; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25743786

Proper citation: RRID:Addgene_107924 Copy   


  • RRID:Addgene_107923

    This resource has 1+ mentions.

http://www.addgene.org/107923

Species: Saccharomyces cerevisiae
Genetic Insert: gRNA-CAN1.Y
Vector Backbone Description: Backbone Marker:George Church (Addgene plasmid # 43803); Backbone Size:5593; Vector Backbone:p426-SNR52p-gRNA.CAN1.Y-SUP4t; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25743786

Proper citation: RRID:Addgene_107923 Copy   


  • RRID:Addgene_107922

    This resource has 1+ mentions.

http://www.addgene.org/107922

Species: Saccharomyces cerevisiae
Genetic Insert: gRNA-CAN1.Y
Vector Backbone Description: Backbone Marker:George Church (Addgene plasmid # 43803); Backbone Size:5775; Vector Backbone:p426-SNR52p-gRNA.CAN1.Y-SUP4t; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25743786

Proper citation: RRID:Addgene_107922 Copy   


  • RRID:Addgene_108364

http://www.addgene.org/108364

Species: Saccharomyces cerevisiae
Genetic Insert: Knock-in Cg TDH3 promoter in Cg YAP1 gene
Vector Backbone Description: Backbone Size:2648; Vector Backbone:pFA6a; Vector Types:Replace C.glabrata YAP1 promoter with C. glabrata TDH3 promoter; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29600281

Proper citation: RRID:Addgene_108364 Copy   


  • RRID:Addgene_108652

    This resource has 1+ mentions.

http://www.addgene.org/108652

Species: Saccharomyces cerevisiae
Genetic Insert: hyBRET-ERK-EV
Vector Backbone Description: Backbone Size:4739; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29895862

Proper citation: RRID:Addgene_108652 Copy   


  • RRID:Addgene_1088

http://www.addgene.org/1088

Species: Saccharomyces cerevisiae
Genetic Insert: SUP35
Vector Backbone Description: Backbone Marker:J. Clos and Brandau, 1994; Backbone Size:0; Vector Backbone:pJC45; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9182769

Proper citation: RRID:Addgene_1088 Copy   


http://www.addgene.org/33131

Species: Saccharomyces cerevisiae
Genetic Insert: RP51A+intron-LacZ
Vector Backbone Description: Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:6308621
Comments: GAL-UAS-CYC1-TATA-C7C1-ATG-RP51A+intron-LacZ

Proper citation: RRID:Addgene_33131 Copy   


  • RRID:Addgene_33149

http://www.addgene.org/33149

Species: Saccharomyces cerevisiae
Genetic Insert: RP51A-synthetic minimal intron
Vector Backbone Description: Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2655924
Comments: Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG

Proper citation: RRID:Addgene_33149 Copy   


  • RRID:Addgene_33148

http://www.addgene.org/33148

Species: Saccharomyces cerevisiae
Genetic Insert: RP51A-synthetic minimal intron
Vector Backbone Description: Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2655924
Comments: Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG

Proper citation: RRID:Addgene_33148 Copy   


  • RRID:Addgene_33232

http://www.addgene.org/33232

Species: Saccharomyces cerevisiae
Genetic Insert: Rad51
Vector Backbone Description: Backbone Size:5857; Vector Backbone:pYES2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20864034

Proper citation: RRID:Addgene_33232 Copy   


  • RRID:Addgene_33230

http://www.addgene.org/33230

Species: Saccharomyces cerevisiae
Genetic Insert: Rad51
Vector Backbone Description: Backbone Size:5857; Vector Backbone:pYES2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20864034

Proper citation: RRID:Addgene_33230 Copy   


  • RRID:Addgene_33150

http://www.addgene.org/33150

Species: Saccharomyces cerevisiae
Genetic Insert: RP51A-synthetic minimal intron
Vector Backbone Description: Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2655924
Comments: Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG

Proper citation: RRID:Addgene_33150 Copy   


  • RRID:Addgene_33151

http://www.addgene.org/33151

Species: Saccharomyces cerevisiae
Genetic Insert: RP51A-synthetic minimal intron
Vector Backbone Description: Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2655924
Comments: Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG Modified intron sequence: GACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG

Proper citation: RRID:Addgene_33151 Copy   


  • RRID:Addgene_34605

http://www.addgene.org/34605

Species: Saccharomyces cerevisiae
Genetic Insert: PYK1
Vector Backbone Description: Backbone Marker:ATCC#87362 (PMID:7737504); Backbone Size:5557; Vector Backbone:P413TEF; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21907146

Proper citation: RRID:Addgene_34605 Copy   


  • RRID:Addgene_34604

http://www.addgene.org/34604

Species: Saccharomyces cerevisiae
Genetic Insert: PYK1
Vector Backbone Description: Backbone Marker:ATCC#87360 (PMID: 7737504; Backbone Size:5739; Vector Backbone:p416GPD; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21907146

Proper citation: RRID:Addgene_34604 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. NIDDK Information Network Resources

    Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within dkNET that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X