Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Saccharomyces cerevisiae
Genetic Insert: MET14
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5886; Vector Backbone:pYES2.1; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29326101
Comments: contains the coding sequence for adenylylsulfate kinase
Proper citation: RRID:Addgene_107441 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: MET10
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5886; Vector Backbone:pYES2.1; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29326101
Comments: contains the coding sequence for the alpha subunit of sulfite reductase
Proper citation: RRID:Addgene_107440 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: gRNA-CAN1.Y, gRNA-ADE2.Y
Vector Backbone Description: Backbone Marker:George Church (Addgene plasmid # 43803); Backbone Size:5280; Vector Backbone:p426-SNR52p-gRNA.CAN1.Y-SUP4t; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25743786
Proper citation: RRID:Addgene_107931 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: gRNA-CAN1.Y, gRNA-ADE2.Y
Vector Backbone Description: Backbone Marker:George Church (Addgene plasmid # 43803); Backbone Size:5660; Vector Backbone:p426-SNR52p-gRNA.CAN1.Y-SUP4t; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25743786
Proper citation: RRID:Addgene_107929 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: gRNA-CAN1.Y, gRNA-ADE2.Y
Vector Backbone Description: Backbone Marker:George Church (Addgene plasmid # 43803); Backbone Size:5817; Vector Backbone:p426-SNR52p-gRNA.CAN1.Y-SUP4t; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25743786
Proper citation: RRID:Addgene_107927 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: gRNA-CAN1.Y, gRNA-ADE2.Y
Vector Backbone Description: Backbone Marker:George Church (Addgene plasmid # 43803); Backbone Size:5577; Vector Backbone:p426-SNR52p-gRNA.CAN1.Y-SUP4t; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25743786
Proper citation: RRID:Addgene_107924 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: gRNA-CAN1.Y
Vector Backbone Description: Backbone Marker:George Church (Addgene plasmid # 43803); Backbone Size:5593; Vector Backbone:p426-SNR52p-gRNA.CAN1.Y-SUP4t; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25743786
Proper citation: RRID:Addgene_107923 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: gRNA-CAN1.Y
Vector Backbone Description: Backbone Marker:George Church (Addgene plasmid # 43803); Backbone Size:5775; Vector Backbone:p426-SNR52p-gRNA.CAN1.Y-SUP4t; Vector Types:Yeast Expression, CRISPR; Bacterial Resistance:Ampicillin
Defining Citation: PMID:25743786
Proper citation: RRID:Addgene_107922 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Knock-in Cg TDH3 promoter in Cg YAP1 gene
Vector Backbone Description: Backbone Size:2648; Vector Backbone:pFA6a; Vector Types:Replace C.glabrata YAP1 promoter with C. glabrata TDH3 promoter; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29600281
Proper citation: RRID:Addgene_108364 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: hyBRET-ERK-EV
Vector Backbone Description: Backbone Size:4739; Vector Backbone:pCAGGS; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:29895862
Proper citation: RRID:Addgene_108652 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: SUP35
Vector Backbone Description: Backbone Marker:J. Clos and Brandau, 1994; Backbone Size:0; Vector Backbone:pJC45; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:9182769
Proper citation: RRID:Addgene_1088 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: RP51A+intron-LacZ
Vector Backbone Description: Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:6308621
Comments: GAL-UAS-CYC1-TATA-C7C1-ATG-RP51A+intron-LacZ
Proper citation: RRID:Addgene_33131 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: RP51A-synthetic minimal intron
Vector Backbone Description: Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2655924
Comments: Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG
Proper citation: RRID:Addgene_33149 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: RP51A-synthetic minimal intron
Vector Backbone Description: Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2655924
Comments: Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG
Proper citation: RRID:Addgene_33148 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Rad51
Vector Backbone Description: Backbone Size:5857; Vector Backbone:pYES2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20864034
Proper citation: RRID:Addgene_33232 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Rad51
Vector Backbone Description: Backbone Size:5857; Vector Backbone:pYES2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:20864034
Proper citation: RRID:Addgene_33230 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: RP51A-synthetic minimal intron
Vector Backbone Description: Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2655924
Comments: Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG
Proper citation: RRID:Addgene_33150 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: RP51A-synthetic minimal intron
Vector Backbone Description: Vector Backbone:pLGSD5; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:2655924
Comments: Original intron sequence: GTATGTTAATATGGTTAACGTCGACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG
Modified intron sequence: GACCGTGTTTTTGATATCTATACTAACAGGCCTTTTAATAG
Proper citation: RRID:Addgene_33151 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: PYK1
Vector Backbone Description: Backbone Marker:ATCC#87362 (PMID:7737504); Backbone Size:5557; Vector Backbone:P413TEF; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21907146
Proper citation: RRID:Addgene_34605 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: PYK1
Vector Backbone Description: Backbone Marker:ATCC#87360 (PMID: 7737504; Backbone Size:5739; Vector Backbone:p416GPD; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
Defining Citation: PMID:21907146
Proper citation: RRID:Addgene_34604 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the dkNET Resources search. From here you can search through a compilation of resources used by dkNET and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that dkNET has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on dkNET then you can log in from here to get additional features in dkNET such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into dkNET you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within dkNET that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.