Resource Summary Report  New Search Previous Search Results

URL: https://dx.doi.org/DOI:10.17504/protocols.io.jgacjse

Authors: Treseder K, Holden S, Maltz M

Summary: DNA ExtractionExtract DNA from sample using the phenol/chloroform procedure or your kit of choice. We typically use the Mo Bio Power Soil DNA extraction kit for extracting DNA from soil and plant litter samples.Use the Nanodrop in the Martiny lab to estimate the concentration and purity of your DNA extraction.Dilute DNA to 10 ng/ul prior to PCR. PCR AmplificationPre-amplification checklist:All pipetting should be done with aerosol barrier, PCR certified pipet tips in a PCR work stationOn ice thaw primers, DNA and PCR master mixDecontaminate pipettors and interior surfaces of a PCR workstation with DNA/RNA Away or 10% bleach solution.UV irradiate PCR work station interior, pipettors and consumables for minimum 15 minAll samples should be amplified in triplicate.Include negative (no template) and positive (DNA isolated from mushroom) controls. Primer information:Forward primer:454 primer B + 'AG' linker + SSU817fGCCTTGCCAGCCCGCTCAGAGTTAGCATGGAATAATRRAATAGGA Reverse Primer:454 primer A + 12-base bar code + 'AC' linker + ssu1196rGCCTCCCTCGCGCCATCAG-12 base bar code-ACTCTGGACCTGGTGAGTTTCCExample barcode: ACACACTATGGCExample primer sequence: GCCTCCCTCGCGCCATCAGACACACTATGGCACTCTGGACCTGGTGAGTTTCC PCR Cocktail:22.5 ul PCR master mix (we use the Invitrogen Platinum PCR SuperMix)1 ul BSA0.75 ul 10 uM forward primer (all samples get the same forward primer)0.75 ul 10 uM reverse primer (all samples get a unique barcoded reverse primer)1 ul template DNA PCR cycle:Samples are initially denatured at 94°C for 10 min, then amplified using 30 cycles of 94°C for 45 sec, 52°C for 30 sec, and 72°C for 90 sec. A final extension of 10 min at 72°C is added at the end of the program to ensure complete amplification of the target region. Check for PCR product on a gel Amplicon CleaningCombine the triplicate PCR reactions into a single volumeClean PCR reactions with a PCR clean up kit. The MoBio UltraClean PCR clean up kit and the Invitrogen Purelink PCR purification kit have both worked well. Amplicon QuantificationUse the qubit system for quantifying DNA, with a few modifications.Instead of using the qubit assay tubes, prepare the samples in black microplates.Perform assay with 1 ul of PCR productRead the plates on the microplate reader in the Allison lab set at 485ex /530em. Estimate amplicon concentration using the standard curve. Amplicon PoolingCombine equal amounts of DNA per sample into single vessel (usually a 15 mL tube).Concentrate pooled amplicons using the Invitorgen Purelink PCR purification kitRun a gel to visualize pooled samplesDepending on how your pooled amplicons look on the gel, you may need to gel purify the pooled amplicons. Pyrosequencing is biased towards shorter reads. If you have a messy band on your gel, it is important to purify your samples to improve the quality of the DNA you will receive. We used the Qiagen QIAquick Gel Extraction Kit. We ran samples out on a 1.4 % gel. The main drawback to performing a gel extraction is that you will almost certainly lose some of your sample. You may need to pool additional PCR product and perform a second gel extraction to obtain enough sample for sequencing. Remove contaminants from gel purified samples using an Invitrogen Purelink PCR purification kit. Estimate final sample concentration and purityUse the qubit system for estimating sample concentration. The sequencing facility requires 2-3 ug of DNA for sequencing.Use the Nanodrop in the Martiny lab for estimating sample purity. Samples with an A260/A280 ratio of ~1.8 typically provide optimal sequencing results. Send sample for sequencingExtract DNA from sample using the phenol/chloroform procedure or your kit of choice. We typically use the Mo Bio Power Soil DNA extraction kit for extracting DNA from soil and plant litter samples.Use the Nanodrop in the Martiny lab to estimate the concentration and purity of your DNA extraction.Dilute DNA to 10 ng/ul prior to PCR. PCR AmplificationPre-amplification checklist:All pipetting should be done with aerosol barrier, PCR certified pipet tips in a PCR work stationOn ice thaw primers, DNA and PCR master mixDecontaminate pipettors and interior surfaces of a PCR workstation with DNA/RNA Away or 10% bleach solution.UV irradiate PCR work station interior, pipettors and consumables for minimum 15 minAll samples should be amplified in triplicate.Include negative (no template) and positive (DNA isolated from mushroom) controls. Primer information:Forward primer:454 primer B + 'AG' linker + SSU817fGCCTTGCCAGCCCGCTCAGAGTTAGCATGGAATAATRRAATAGGA Reverse Primer:454 primer A + 12-base bar code + 'AC' linker + ssu1196rGCCTCCCTCGCGCCATCAG-12 base bar code-ACTCTGGACCTGGTGAGTTTCCExample barcode: ACACACTATGGCExample primer sequence: GCCTCCCTCGCGCCATCAGACACACTATGGCACTCTGGACCTGGTGAGTTTCC PCR Cocktail:22.5 ul PCR master mix (we use the Invitrogen Platinum PCR SuperMix)1 ul BSA0.75 ul 10 uM forward primer (all samples get the same forward primer)0.75 ul 10 uM reverse primer (all samples get a unique barcoded reverse primer)1 ul template DNA PCR cycle:Samples are initially denatured at 94°C for 10 min, then amplified using 30 cycles of 94°C for 45 sec, 52°C for 30 sec, and 72°C for 90 sec. A final extension of 10 min at 72°C is added at the end of the program to ensure complete amplification of the target region. Check for PCR product on a gel Amplicon CleaningCombine the triplicate PCR reactions into a single volumeClean PCR reactions with a PCR clean up kit. The MoBio UltraClean PCR clean up kit and the Invitrogen Purelink PCR purification kit have both worked well. Amplicon QuantificationUse the qubit system for quantifying DNA, with a few modifications.Instead of using the qubit assay tubes, prepare the samples in black microplates.Perform assay with 1 ul of PCR productRead the plates on the microplate reader in the Allison lab set at 485ex /530em. Estimate amplicon concentration using the standard curve. Amplicon PoolingCombine equal amounts of DNA per sample into single vessel (usually a 15 mL tube).Concentrate pooled amplicons using the Invitorgen Purelink PCR purification kitRun a gel to visualize pooled samplesDepending on how your pooled amplicons look on the gel, you may need to gel purify the pooled amplicons. Pyrosequencing is biased towards shorter reads. If you have a messy band on your gel, it is important to purify your samples to improve the quality of the DNA you will receive. We used the Qiagen QIAquick Gel Extraction Kit. We ran samples out on a 1.4 % gel. The main drawback to performing a gel extraction is that you will almost certainly lose some of your sample. You may need to pool additional PCR product and perform a second gel extraction to obtain enough sample for sequencing. Remove contaminants from gel purified samples using an Invitrogen Purelink PCR purification kit. Estimate final sample concentration and purityUse the qubit system for estimating sample concentration. The sequencing facility requires 2-3 ug of DNA for sequencing.Use the Nanodrop in the Martiny lab for estimating sample purity. Samples with an A260/A280 ratio of ~1.8 typically provide optimal sequencing results. Send sample for sequencingSend samples to the Engencore sequencing facility at the University of South Carolina. Check their website for more specific details about what else to include in the shipment.Send samples overnight on dry ice PCR AmplificationPre-amplification checklist:All pipetting should be done with aerosol barrier, PCR certified pipet tips in a PCR work stationOn ice thaw primers, DNA and PCR master mixDecontaminate pipettors and interior surfaces of a PCR workstation with DNA/RNA Away or 10% bleach solution.UV irradiate PCR work station interior, pipettors and consumables for minimum 15 minAll samples should be amplified in triplicate.Include negative (no template) and positive (DNA isolated from mushroom) controls. Primer information:Forward primer:454 primer B + 'AG' linker + SSU817fGCCTTGCCAGCCCGCTCAGAGTTAGCATGGAATAATRRAATAGGA Reverse Primer:454 primer A + 12-base bar code + 'AC' linker + ssu1196rGCCTCCCTCGCGCCATCAG-12 base bar code-ACTCTGGACCTGGTGAGTTTCCExample barcode: ACACACTATGGCExample primer sequence: GCCTCCCTCGCGCCATCAGACACACTATGGCACTCTGGACCTGGTGAGTTTCC PCR Cocktail:22.5 ul PCR master mix (we use the Invitrogen Platinum PCR SuperMix)1 ul BSA0.75 ul 10 uM forward primer (all samples get the same forward primer)0.75 ul 10 uM reverse primer (all samples get a unique barcoded reverse primer)1 ul template DNA PCR cycle:Samples are initially denatured at 94°C for 10 min, then amplified using 30 cycles of 94°C for 45 sec, 52°C for 30 sec, and 72°C for 90 sec. A final extension of 10 min at 72°C is added at the end of the program to ensure complete amplification of the target region. Check for PCR product on a gel Amplicon CleaningCombine the triplicate PCR reactions into a single volumeClean PCR reactions with a PCR clean up kit. The MoBio UltraClean PCR clean up kit and the Invitrogen Purelink PCR purification kit have both worked well. Amplicon QuantificationUse the qubit system for quantifying DNA, with a few modifications.Instead of using the qubit assay tubes, prepare the samples in black microplates.Perform assay with 1 ul of PCR productRead the plates on the microplate reader in the Allison lab set at 485ex /530em. Estimate amplicon concentration using the standard curve. Amplicon PoolingCombine equal amounts of DNA per sample into single vessel (usually a 15 mL tube).Concentrate pooled amplicons using the Invitorgen Purelink PCR purification kitRun a gel to visualize pooled samplesDepending on how your pooled amplicons look on the gel, you may need to gel purify the pooled amplicons. Pyrosequencing is biased towards shorter reads. If you have a messy band on your gel, it is important to purify your samples to improve the quality of the DNA you will receive. We used the Qiagen QIAquick Gel Extraction Kit. We ran samples out on a 1.4 % gel. The main drawback to performing a gel extraction is that you will almost certainly lose some of your sample. You may need to pool additional PCR product and perform a second gel extraction to obtain enough sample for sequencing. Remove contaminants from gel purified samples using an Invitrogen Purelink PCR purification kit. Estimate final sample concentration and purityUse the qubit system for estimating sample concentration. The sequencing facility requires 2-3 ug of DNA for sequencing.Use the Nanodrop in the Martiny lab for estimating sample purity. Samples with an A260/A280 ratio of ~1.8 typically provide optimal sequencing results. Send sample for sequencingPre-amplification checklist:All pipetting should be done with aerosol barrier, PCR certified pipet tips in a PCR work stationOn ice thaw primers, DNA and PCR master mixDecontaminate pipettors and interior surfaces of a PCR workstation with DNA/RNA Away or 10% bleach solution.UV irradiate PCR work station interior, pipettors and consumables for minimum 15 minAll samples should be amplified in triplicate.Include negative (no template) and positive (DNA isolated from mushroom) controls. Primer information:Forward primer:454 primer B + 'AG' linker + SSU817fGCCTTGCCAGCCCGCTCAGAGTTAGCATGGAATAATRRAATAGGA Reverse Primer:454 primer A + 12-base bar code + 'AC' linker + ssu1196rGCCTCCCTCGCGCCATCAG-12 base bar code-ACTCTGGACCTGGTGAGTTTCCExample barcode: ACACACTATGGCExample primer sequence: GCCTCCCTCGCGCCATCAGACACACTATGGCACTCTGGACCTGGTGAGTTTCC PCR Cocktail:22.5 ul PCR master mix (we use the Invitrogen Platinum PCR SuperMix)1 ul BSA0.75 ul 10 uM forward primer (all samples get the same forward primer)0.75 ul 10 uM reverse primer (all samples get a unique barcoded reverse primer)1 ul template DNA PCR cycle:Samples are initially denatured at 94°C for 10 min, then amplified using 30 cycles of 94°C for 45 sec, 52°C for 30 sec, and 72°C for 90 sec. A final extension of 10 min at 72°C is added at the end of the program to ensure complete amplification of the target region. Check for PCR product on a gel Amplicon CleaningCombine the triplicate PCR reactions into a single volumeClean PCR reactions with a PCR clean up kit. The MoBio UltraClean PCR clean up kit and the Invitrogen Purelink PCR purification kit have both worked well. Amplicon QuantificationUse the qubit system for quantifying DNA, with a few modifications.Instead of using the qubit assay tubes, prepare the samples in black microplates.Perform assay with 1 ul of PCR productRead the plates on the microplate reader in the Allison lab set at 485ex /530em. Estimate amplicon concentration using the standard curve. Amplicon PoolingCombine equal amounts of DNA per sample into single vessel (usually a 15 mL tube).Concentrate pooled amplicons using the Invitorgen Purelink PCR purification kitRun a gel to visualize pooled samplesDepending on how your pooled amplicons look on the gel, you may need to gel purify the pooled amplicons. Pyrosequencing is biased towards shorter reads. If you have a messy band on your gel, it is important to purify your samples to improve the quality of the DNA you will receive. We used the Qiagen QIAquick Gel Extraction Kit. We ran samples out on a 1.4 % gel. The main drawback to performing a gel extraction is that you will almost certainly lose some of your sample. You may need to pool additional PCR product and perform a second gel extraction to obtain enough sample for sequencing. Remove contaminants from gel purified samples using an Invitrogen Purelink PCR purification kit. Estimate final sample concentration and purityUse the qubit system for estimating sample concentration. The sequencing facility requires 2-3 ug of DNA for sequencing.Use the Nanodrop in the Martiny lab for estimating sample purity. Samples with an A260/A280 ratio of ~1.8 typically provide optimal sequencing results. Send sample for sequencingSend samples to the Engencore sequencing facility at the University of South Carolina. Check their website for more specific details about what else to include in the shipment.Send samples overnight on dry icePrimer information:Forward primer:454 primer B + 'AG' linker + SSU817fGCCTTGCCAGCCCGCTCAGAGTTAGCATGGAATAATRRAATAGGAReverse Primer:454 primer A + 12-base bar code + 'AC' linker + ssu1196rGCCTCCCTCGCGCCATCAG-12 base bar code-ACTCTGGACCTGGTGAGTTTCCExample barcode: ACACACTATGGCExample primer sequence: GCCTCCCTCGCGCCATCAGACACACTATGGCACTCTGGACCTGGTGAGTTTCCPCR Cocktail:22.5 ul PCR master mix (we use the Invitrogen Platinum PCR SuperMix)1 ul BSA0.75 ul 10 uM forward primer (all samples get the same forward primer)0.75 ul 10 uM reverse primer (all samples get a unique barcoded reverse primer)1 ul template DNAPCR cycle:Samples are initially denatured at 94°C for 10 min, then amplified using 30 cycles of 94°C for 45 sec, 52°C for 30 sec, and 72°C for 90 sec. A final extension of 10 min at 72°C is added at the end of the program to ensure complete amplification of the target region. Check for PCR product on a gel Amplicon CleaningCombine the triplicate PCR reactions into a single volumeClean PCR reactions with a PCR clean up kit. The MoBio UltraClean PCR clean up kit and the Invitrogen Purelink PCR purification kit have both worked well. Amplicon QuantificationUse the qubit system for quantifying DNA, with a few modifications.Instead of using the qubit assay tubes, prepare the samples in black microplates.Perform assay with 1 ul of PCR productRead the plates on the microplate reader in the Allison lab set at 485ex /530em. Estimate amplicon concentration using the standard curve. Amplicon PoolingCombine equal amounts of DNA per sample into single vessel (usually a 15 mL tube).Concentrate pooled amplicons using the Invitorgen Purelink PCR purification kitRun a gel to visualize pooled samplesDepending on how your pooled amplicons look on the gel, you may need to gel purify the pooled amplicons. Pyrosequencing is biased towards shorter reads. If you have a messy band on your gel, it is important to purify your samples to improve the quality of the DNA you will receive. We used the Qiagen QIAquick Gel Extraction Kit. We ran samples out on a 1.4 % gel. The main drawback to performing a gel extraction is that you will almost certainly lose some of your sample. You may need to pool additional PCR product and perform a second gel extraction to obtain enough sample for sequencing. Remove contaminants from gel purified samples using an Invitrogen Purelink PCR purification kit. Estimate final sample concentration and purityUse the qubit system for estimating sample concentration. The sequencing facility requires 2-3 ug of DNA for sequencing.Use the Nanodrop in the Martiny lab for estimating sample purity. Samples with an A260/A280 ratio of ~1.8 typically provide optimal sequencing results. Send sample for sequencing Amplicon CleaningCombine the triplicate PCR reactions into a single volumeClean PCR reactions with a PCR clean up kit. The MoBio UltraClean PCR clean up kit and the Invitrogen Purelink PCR purification kit have both worked well. Amplicon QuantificationUse the qubit system for quantifying DNA, with a few modifications.Instead of using the qubit assay tubes, prepare the samples in black microplates.Perform assay with 1 ul of PCR productRead the plates on the microplate reader in the Allison lab set at 485ex /530em. Estimate amplicon concentration using the standard curve. Amplicon PoolingCombine equal amounts of DNA per sample into single vessel (usually a 15 mL tube).Concentrate pooled amplicons using the Invitorgen Purelink PCR purification kitRun a gel to visualize pooled samplesDepending on how your pooled amplicons look on the gel, you may need to gel purify the pooled amplicons. Pyrosequencing is biased towards shorter reads. If you have a messy band on your gel, it is important to purify your samples to improve the quality of the DNA you will receive. We used the Qiagen QIAquick Gel Extraction Kit. We ran samples out on a 1.4 % gel. The main drawback to performing a gel extraction is that you will almost certainly lose some of your sample. You may need to pool additional PCR product and perform a second gel extraction to obtain enough sample for sequencing. Remove contaminants from gel purified samples using an Invitrogen Purelink PCR purification kit. Estimate final sample concentration and purityUse the qubit system for estimating sample concentration. The sequencing facility requires 2-3 ug of DNA for sequencing.Use the Nanodrop in the Martiny lab for estimating sample purity. Samples with an A260/A280 ratio of ~1.8 typically provide optimal sequencing results. Send sample for sequencingCombine the triplicate PCR reactions into a single volumeClean PCR reactions with a PCR clean up kit. The MoBio UltraClean PCR clean up kit and the Invitrogen Purelink PCR purification kit have both worked well. Amplicon QuantificationUse the qubit system for quantifying DNA, with a few modifications.Instead of using the qubit assay tubes, prepare the samples in black microplates.Perform assay with 1 ul of PCR productRead the plates on the microplate reader in the Allison lab set at 485ex /530em. Estimate amplicon concentration using the standard curve. Amplicon PoolingCombine equal amounts of DNA per sample into single vessel (usually a 15 mL tube).Concentrate pooled amplicons using the Invitorgen Purelink PCR purification kitRun a gel to visualize pooled samplesDepending on how your pooled amplicons look on the gel, you may need to gel purify the pooled amplicons. Pyrosequencing is biased towards shorter reads. If you have a messy band on your gel, it is important to purify your samples to improve the quality of the DNA you will receive. We used the Qiagen QIAquick Gel Extraction Kit. We ran samples out on a 1.4 % gel. The main drawback to performing a gel extraction is that you will almost certainly lose some of your sample. You may need to pool additional PCR product and perform a second gel extraction to obtain enough sample for sequencing. Remove contaminants from gel purified samples using an Invitrogen Purelink PCR purification kit. Estimate final sample concentration and purityUse the qubit system for estimating sample concentration. The sequencing facility requires 2-3 ug of DNA for sequencing.Use the Nanodrop in the Martiny lab for estimating sample purity. Samples with an A260/A280 ratio of ~1.8 typically provide optimal sequencing results. Send sample for sequencingSend samples to the Engencore sequencing facility at the University of South Carolina. Check their website for more specific details about what else to include in the shipment.Send samples overnight on dry ice Amplicon QuantificationUse the qubit system for quantifying DNA, with a few modifications.Instead of using the qubit assay tubes, prepare the samples in black microplates.Perform assay with 1 ul of PCR productRead the plates on the microplate reader in the Allison lab set at 485ex /530em. Estimate amplicon concentration using the standard curve. Amplicon PoolingCombine equal amounts of DNA per sample into single vessel (usually a 15 mL tube).Concentrate pooled amplicons using the Invitorgen Purelink PCR purification kitRun a gel to visualize pooled samplesDepending on how your pooled amplicons look on the gel, you may need to gel purify the pooled amplicons. Pyrosequencing is biased towards shorter reads. If you have a messy band on your gel, it is important to purify your samples to improve the quality of the DNA you will receive. We used the Qiagen QIAquick Gel Extraction Kit. We ran samples out on a 1.4 % gel. The main drawback to performing a gel extraction is that you will almost certainly lose some of your sample. You may need to pool additional PCR product and perform a second gel extraction to obtain enough sample for sequencing. Remove contaminants from gel purified samples using an Invitrogen Purelink PCR purification kit. Estimate final sample concentration and purityUse the qubit system for estimating sample concentration. The sequencing facility requires 2-3 ug of DNA for sequencing.Use the Nanodrop in the Martiny lab for estimating sample purity. Samples with an A260/A280 ratio of ~1.8 typically provide optimal sequencing results. Send sample for sequencingUse the qubit system for quantifying DNA, with a few modifications.Instead of using the qubit assay tubes, prepare the samples in black microplates.Perform assay with 1 ul of PCR productRead the plates on the microplate reader in the Allison lab set at 485ex /530em. Estimate amplicon concentration using the standard curve. Amplicon PoolingCombine equal amounts of DNA per sample into single vessel (usually a 15 mL tube).Concentrate pooled amplicons using the Invitorgen Purelink PCR purification kitRun a gel to visualize pooled samplesDepending on how your pooled amplicons look on the gel, you may need to gel purify the pooled amplicons. Pyrosequencing is biased towards shorter reads. If you have a messy band on your gel, it is important to purify your samples to improve the quality of the DNA you will receive. We used the Qiagen QIAquick Gel Extraction Kit. We ran samples out on a 1.4 % gel. The main drawback to performing a gel extraction is that you will almost certainly lose some of your sample. You may need to pool additional PCR product and perform a second gel extraction to obtain enough sample for sequencing. Remove contaminants from gel purified samples using an Invitrogen Purelink PCR purification kit. Estimate final sample concentration and purityUse the qubit system for estimating sample concentration. The sequencing facility requires 2-3 ug of DNA for sequencing.Use the Nanodrop in the Martiny lab for estimating sample purity. Samples with an A260/A280 ratio of ~1.8 typically provide optimal sequencing results. Send sample for sequencingSend samples to the Engencore sequencing facility at the University of South Carolina. Check their website for more specific details about what else to include in the shipment.Send samples overnight on dry ice Amplicon PoolingCombine equal amounts of DNA per sample into single vessel (usually a 15 mL tube).Concentrate pooled amplicons using the Invitorgen Purelink PCR purification kitRun a gel to visualize pooled samplesDepending on how your pooled amplicons look on the gel, you may need to gel purify the pooled amplicons. Pyrosequencing is biased towards shorter reads. If you have a messy band on your gel, it is important to purify your samples to improve the quality of the DNA you will receive. We used the Qiagen QIAquick Gel Extraction Kit. We ran samples out on a 1.4 % gel. The main drawback to performing a gel extraction is that you will almost certainly lose some of your sample. You may need to pool additional PCR product and perform a second gel extraction to obtain enough sample for sequencing. Remove contaminants from gel purified samples using an Invitrogen Purelink PCR purification kit. Estimate final sample concentration and purityUse the qubit system for estimating sample concentration. The sequencing facility requires 2-3 ug of DNA for sequencing.Use the Nanodrop in the Martiny lab for estimating sample purity. Samples with an A260/A280 ratio of ~1.8 typically provide optimal sequencing results. Send sample for sequencingCombine equal amounts of DNA per sample into single vessel (usually a 15 mL tube).Concentrate pooled amplicons using the Invitorgen Purelink PCR purification kitRun a gel to visualize pooled samplesDepending on how your pooled amplicons look on the gel, you may need to gel purify the pooled amplicons. Pyrosequencing is biased towards shorter reads. If you have a messy band on your gel, it is important to purify your samples to improve the quality of the DNA you will receive. We used the Qiagen QIAquick Gel Extraction Kit. We ran samples out on a 1.4 % gel. The main drawback to performing a gel extraction is that you will almost certainly lose some of your sample. You may need to pool additional PCR product and perform a second gel extraction to obtain enough sample for sequencing. Remove contaminants from gel purified samples using an Invitrogen Purelink PCR purification kit. Estimate final sample concentration and purityUse the qubit system for estimating sample concentration. The sequencing facility requires 2-3 ug of DNA for sequencing.Use the Nanodrop in the Martiny lab for estimating sample purity. Samples with an A260/A280 ratio of ~1.8 typically provide optimal sequencing results. Send sample for sequencingSend samples to the Engencore sequencing facility at the University of South Carolina. Check their website for more specific details about what else to include in the shipment.Send samples overnight on dry ice Estimate final sample concentration and purityUse the qubit system for estimating sample concentration. The sequencing facility requires 2-3 ug of DNA for sequencing.Use the Nanodrop in the Martiny lab for estimating sample purity. Samples with an A260/A280 ratio of ~1.8 typically provide optimal sequencing results. Send sample for sequencingUse the qubit system for estimating sample concentration. The sequencing facility requires 2-3 ug of DNA for sequencing.Use the Nanodrop in the Martiny lab for estimating sample purity. Samples with an A260/A280 ratio of ~1.8 typically provide optimal sequencing results. Send sample for sequencingSend samples to the Engencore sequencing facility at the University of South Carolina. Check their website for more specific details about what else to include in the shipment.Send samples overnight on dry iceSend samples to the Engencore sequencing facility at the University of South Carolina. Check their website for more specific details about what else to include in the shipment.Send samples overnight on dry ice

Associated Publications: Maltz MR, Treseder KK, McGuire KL (2017) Links between plant and fungal diversity in habitat fragments of coastal shrubland. PLoS ONE 12(9): e0184991. doi: 10.1371/journal.pone.0184991

Affiliations: UC Irvine, Stanford University, UC Riverside

External URL: https://doi.org/10.1371/journal.pone.0184991

Version: 1

Publication Date: 2017

Expand All Collapse