Resource Summary Report  New Search Previous Search Results

URL: https://dx.doi.org/DOI:10.17504/protocols.io.ipgcdjw

Authors: Feng-ling Xu; Mei Ding; Jun Yao; Zhang-sen Shi; Bao-jie Wang

Summary: The four SNPs (C5178A, A10398G, G13708A, and C13928G) in the mtDNA coding region were detected using PCR-RFLP analysis. The primers listed in able 2 were used to amplify target fragments. The mismatch method was applied to generate an HpyCH4Ⅲ artificial restriction endonuclease site in the amplified fragment that included the C13928G SNP. The 20 µl PCR reactions contained 2.0 µl 10×buffer, 2 µl 2.5 mM dNTP mix, 2 µl each of R and F PCR primers (10pM each), 0.2 µl of rTaq Enzyme (5 U/µl), and 20 ng of template DNA. PCR was performed under the following cycle conditions: initial denaturation of 94 °C for 5 minutes; followed by 30 cycles of 94 °C denaturation for 30 seconds, annealing at 61-65°C (Table 2) for 30 seconds, and elongation at 72 °C for 30 seconds; followed by a final extension at 72 °C for 5 minutes. PCR products were digested with restriction enzymes (S1 Table), and fragments were detected on 6% polyacrylamide gel. A1Table 2. Primers used for the analysis of mtDNA polymorphisms in the hypervariable region and the coding region. 2Locus Annealing Temperature (°C) Primer Sequences (5ʹ → 3ʹ)      3Hypervariable L15869 F   5' AAAATACTCAAATGGGCCTGTC 3'      4Regions      5  H719  R   5' CGTGGTGATTTAGAGGGTGAAC 3'  6  16539 F    5' ACACGTTCCCCTTAAATAAGAC 3'  7  80   R     5' AGCGTCTCGCAATGCTATCG 3'  85178 61°C 5178  F    5' ATCTCTCCCTCACTAAACGTAAGCCTT 3' 9  5178  R    5' TTAGTATAAAAGGGGAGATAGGTAGGAGTAGC 3' 1010398 64°C 10398 F    5' GCCCTCCTTTTACCCCTACCA 3'  11  10398 R    5' GGGAGGATATGAGGTGTGAGCGAT 3' 1213708 65°C 13708 F    5' TCATCGCTACCTCCCTGACAAG 3'  13  13708 R    5' ATGCTAGGGTAGAATCCGAGTATGTT 3' 1413928 61°C 13928 F    5' TATTCGCAGGATTTCTCATTACTAACAACATTTC 3' 1513928 R    5' AAAATATATAAGGATTGTGCGGTGTGTGACG 3' a      16a Mismatched base.

Affiliations: School of Forensic Medicine, China Medical University, Shenyang, 110122, China

Version: 1

Publication Date: 2017

Expand All Collapse