Resource Summary Report  New Search Previous Search Results

URL: https://dx.doi.org/DOI:10.17504/protocols.io.baa8iahw

Authors: Bernardo Pollak

Group: uLoop - Diatom Parts Registry

Summary: Name: pL0R-LacZDescription: a L0 receiver vector which can be used for domestication using SapI-mediated restriction ligation or Gibson assembly. Contains lacZ for blue/white colony screening. Requires X-GAL, IPTG optional depending on E. coli strain.Level 0 Overhangs: Special (cuts into BsaI sites)Length: 2646Antibiotic selection: SpectynomycinOther info: pMB1 oriCharacterisation: ++++ (substantial), works as expected.Primers: AB1U1FCATTACTCGCATCCATTCTC2U1RGAGACGAGACGAGACAGCCT3UXFCCAGGATACATAGATTACCA4UXRGGTGGAAGGGCTCGGAGTTG5L0FTGGGCTGCCTGTATCGAGTG6L0RGCTGGCCTTTTGCTCACA L0 F works great for sequencing.Submitter: Bernardo PollakCloned by: Bernardo PollakAvailability: Upon request at the Pollak/Dupont/Federici labs at the moment and will be available soon from Addgene.

Affiliations: J. Craig Venter Institute/PUC

External URL: https://www.uloop.org/domestication.html

Version: 1

Publication Date: 2019

Expand All Collapse