Resource Summary Report  New Search Previous Search Results

URL: https://dx.doi.org/10.17504/protocols.io.zeef3be

Authors: Ana Ximena Kiguen, Jessica Paola Mosmann, Raul Fernando Venezuela, Cecilia Gabriela Cuffini

Summary: OmpA gene PCR: PCR DNA extract (5 μl) was used to amplify a 1087 pb fragment of the ompA gene of C. trachomatis, using primers NRO (5’CTCAACTGTAACTGCGTATTT3’) and NLO (5’ATGAAAAAACTCTTGAAATCG3´). PCR amplification processes commenced with a 4-minute denaturation step at 95°C and continued with 49 amplification cycles. Each cycle consisted of a first denaturation step at 95°C for 1 min, an annealing step at 55°C for 1 min and a final step of chain elongation at 72° C for 1.5 min. .justify:after { content: ""; display:inline-block; width: 100%; } Cryptic Plasmid PCR: The primers used to generate a 201-bp fragment from the cryptic plasmid of C. trachomatis were CTP1 (5'-TAGTAACTGCCAClTCATCA-3') and CTP2 (5'-TTCCCCTTGTAATTCGTTGC-3'). The PCR amplification consisted of DNA denaturation at 95°C for 4 min followed by 35 cycles of amplification. Each cycle consisted of 1 min at 95°C, 1 min at 55°C and 1.5 min at 72°C followed by a final elongation at 72°C for 4 min. The ompA gene and cryptic plasmid PCR products were visualized after electrophoresis in a 1% agarose gel by ECO-Gel 20.000X Highway staining. Positive and negative controls were used in all determinations of PCR. .justify:after { content: ""; display:inline-block; width: 100%; }

Associated Publications: Kiguen AX, Marramá M, Ruiz S, Estofan P, Venezuela RF, Mosmann JP, Monetti MS, Rivero V, Cuffini CG (2019) Prevalence, risk factors and molecular characterization of Chlamydia trachomatis in pregnant women from Córdoba, Argentina: A prospective study. PLoS ONE 14(5): e0217245. doi: 10.1371/journal.pone.0217245

Affiliations: Instituto de Virología Dr JM Vanella. Facultad de Ciencias Médicas. Universidad Nacional de Córdoba. Argentina, Instituto de Virología Dr JM Vanella. Facultad de Ciencias Médicas. Universidad Nacional de Córdoba. Argentina, Instituto de Virología Dr JM Vanella. Facultad de Ciencias Médicas. Universidad Nacional de Córdoba. Argentina, Instituto de Virología Dr JM Vanella. Facultad de Ciencias Médicas. Universidad Nacional de Córdoba. Argentina

External URL: https://doi.org/10.1371/journal.pone.0217245

Version: 1

Publication Date: 2019

Expand All Collapse