Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.wormbase.org/db/get?name=WBStrain00063328
Proper Citation: RRID:WB-STRAIN:WBStrain00063328
Description: Caenorhabditis elegans with name mrps-25 (hd7151 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-2 7p::neoR::unc-54 3 UTR + loxP])/tmC25 [unc-5(tm9708)] IV. from WB.
Species: Caenorhabditis elegans
Synonyms: mrps-25 (hd7151 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-2 7p::neoR::unc-54 3 UTR + loxP])/tmC25 [unc-5(tm9708)] IV.
Notes: Apparent homozygous lethal or sterile deletion balanced with tmC25. Maintain by picking wild-type GFP+. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+ and Unc animals (tmC25 [unc-5(tm9708)] homozygotes). Derived from parental strains VH7151 and FX30257. hd7151 is a deletion of 435 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Left flanking Sequence: ATGCCGATAAAGTTGTGACGCCCTTTGCCA; Right flanking sequence: TGTCGATCTTCCTTGTTTTTTGTTGAAAAA. sgRNA #1: AAACTTACTCAGATATGCTC; sgRNA #2: CAAAAACTAGCTAGAAATAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: VH KO group"
Affected Gene: WBGene00003514(myo-2)|WBGene00004471(rps-2)|WBGene00006745(unc-5)|WBGene00006789(unc-54)|WBGene00021920(mrps-25)
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for mrps-25 (hd7151 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-2 7p::neoR::unc-54 3 UTR + loxP])/tmC25 [unc-5(tm9708)] IV..
No alerts have been found for mrps-25 (hd7151 [loxP + myo-2p::GFP::unc-54 3 UTR + rps-2 7p::neoR::unc-54 3 UTR + loxP])/tmC25 [unc-5(tm9708)] IV..
Source: Integrated Animals
Source Database: WormBase (WB)