Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.wormbase.org/db/get?name=WBStrain00049435
Proper Citation: RRID:WB-STRAIN:WBStrain00049435
Description: Caenorhabditis elegans with name csn-1(ve696[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ V. from WB.
Species: Caenorhabditis elegans
Synonyms: csn-1(ve696[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ V.
Notes: Homozygous sterile deletion as unbalanced heterozygote. Deletion of 5448 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Pick viable fertile GFP+ animals to maintain. Heterozygotes are wild-type dim GFP+ and segregate wild-type dim GFP+, bright GFP+ sterile adults (ve696 homozygotes), and non-GFP wild-type homozygotes.Left flanking Sequence: cgcataaaggttttccggcatcgaggtctc ; Right flanking sequence: tggaaaaaatgaatctcgagggattttgag. sgRNA #1: accacgattaccgtatctgg; sgRNA #2: GCTGGGATTGTTGACTGTTc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.Note: This allele cannot be balanced by sC4 because it is contained within a deleted region. See Maroilley et al. Sci Reports (2021)11:18258 for more details. doi.org/10.1038/s41598-021-97764-9|"Homozygous sterile. Deletion of 5448 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+, and segregate wild-type GFP+, GFP+ sterile adults (ve696 homozygotes) and arrested non-GFP (stage unknown) (sC4 homozygotes). Maintain by picking wild-type GFP+.Left flanking Sequence: cgcataaaggttttccggcatcgaggtctc ; Right flanking sequence: tggaaaaaatgaatctcgagggattttgag. sgRNA #1: accacgattaccgtatctgg; sgRNA #2: GCTGGGATTGTTGACTGTTc. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."|"Made_by: RG KO Group"
Affected Gene: WBGene00000813(csn-1)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for csn-1(ve696[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ V..
No alerts have been found for csn-1(ve696[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/+ V..
Source: Integrated Animals
Source Database: WormBase (WB)