Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.wormbase.org/db/get?name=WBStrain00005113
Proper Citation: RRID:WB-STRAIN:WBStrain00005113
Description: Caenorhabditis elegans with name smg-1(cc546ts); dvIs27 [Pmyo-3::human Amyloid beta 1-42; let-851 3'UTR; rol-6(su1006)] from WB.
Species: Caenorhabditis elegans
Synonyms: smg-1(cc546ts); dvIs27 [Pmyo-3::human Amyloid beta 1-42; let-851 3'UTR; rol-6(su1006)]
Notes: dvIs27 [myo-3p::A-Beta (1-42)::let-851 3'UTR) + rol-6(su1006)] X. Rollers. Temperature sensitive: needs to be propagated at 15C. Upshift larval animals to check that the worms get paralyzed and give offspring that arrest as eggs/early larvae. This strain produces low levels of beta amyloid peptide even when grown at low temperature, and therefore there is always some selection for loss of transgene copies. It is recommended to maintain growing stock plates at 15-16 degrees C by transferring small numbers of animals each generation rather than by chunking, which increases the effective population size and therefore the chance of a relatively rare transgene loss, and then this revertant taking over the population. The strain should also be frozen shortly after being received. This strain can only be sent to academic users and not to commercial organizations. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).]|"expresses the human A42 peptide in its body-wall muscle cells in a temperature-sensitive manner."|"Supplementary_genotype (dvIs27[myo-3p::A-Beta (1-42)::let-851 30UTR) C rol-6(su1006)]) X"|"Supplementary_genotype (smg-1ts[pAF29(myo-3/Ab1-42/let UTR) + pRF4(rol-6(su10069))])"|"Supplementary_genotype smg-1(cc546) I; dvIs27[myo-3p::A-Beta (1-42)::let-851 3'UTR) + rol-6(su1006)] X"|"Supplementary_genotype smg-1(cc546)I;dvIs27[myo-3p::A1-42::let-851 3'UTR + rol-6(su1006)]X"|"WBStrain provided so WBPaper00059477 paper added based on AFP_Strain data."|"[2020-08-03T21:01:59.096Z WBPerson324] Ressurect Strain: Genotype: smg-1(cc546ts); dvIs27 [Pmyo-3::human Amyloid beta 1-42; let-851 3'UTR; rol-6(su1006)]"
Affected Gene: WBGene00004879(smg-1)
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for CL4176.
No alerts have been found for CL4176.
Source: Integrated Animals
Source Database: WormBase (WB)