Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=13702080
Proper Citation: RRID:RRRC_00831
Description: Rattus norvegicus with name SD-Ahrem1Soar from RGD.
Species: Rattus norvegicus
Notes: CRISPR/Cas9 targeted deletion of the Ahr basic helix loop helix DNA binding domain of the rat Ahr was injected into the embyos of outbred HsdHot:SD. The gRNA was targeted to Exon 2 of the Ahr gene, which encodes the bHLH DNA binding domain (target sequence: CTTCTAAACGACACAGAGACCGG; corresponding to NM_001308254). The established Ahr null strain lacks responsiveness to Ahr ligands. Rat Resource and Research Center
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for SD-Ahrem1Soar .
No alerts have been found for SD-Ahrem1Soar .
Source: Integrated Animals
Source Database: Rat Resource and Research Center (RRRC)