SYSTEM UPDATE: We will be performing system maintenace Saturday September 26 at 9pm to midnight Pacific Time

Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
Organism Name
SD-Ahrem1Soar
RRID:RRRC_00831 RRID Copied  
PDF Report How to cite
RRID:RRRC_00831
Copy Citation Copied
Organism Information

URL: http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=13702080

Proper Citation: RRID:RRRC_00831

Description: Rattus norvegicus with name SD-Ahrem1Soar from RGD.

Species: Rattus norvegicus

Notes: CRISPR/Cas9 targeted deletion of the Ahr basic helix loop helix DNA binding domain of the rat Ahr was injected into the embyos of outbred HsdHot:SD. The gRNA was targeted to Exon 2 of the Ahr gene, which encodes the bHLH DNA binding domain (target sequence: CTTCTAAACGACACAGAGACCGG; corresponding to NM_001308254). The established Ahr null strain lacks responsiveness to Ahr ligands. Rat Resource and Research Center

Expand All
Usage and Citation Metrics

We found {{ ctrl2.mentions.all_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location


{{ ctrl2.mentions.errors.location }}

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts

No rating or validation information has been found for SD-Ahrem1Soar .

No alerts have been found for SD-Ahrem1Soar .

Data and Source Information

Source: Rat Resource and Research Center (RRID:SCR_002044)
Description: Supplies biomedical investigators with rat models, embryonic stem cells, related reagents, and protocols they require for their research. In addition to repository, cryostorage and distribution functions, RRRC can facilitate acquisition of rat strains from other international repositories as well as provide consultation and technical training to investigators using rat models.
URL: http://www.rrrc.us/

Source Database: Rat Resource and Research Center (RRRC)