Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=617154644
Proper Citation: RRID:RGD_617154644
Description: Rattus norvegicus with name LE-Elovl4 em1cgen-/- from RGD.
Species: Rattus norvegicus
Notes: The CRISPR/Cas9 genetic editing approach was used to generate .a homozygous Long-Evans rat model of human SCA34. The human Cas9 D10A (hCas9-D10A) nickase was used to knock-in the c.736T>G mutation by targeting exon 6 of the rat Elovl4 (Ensembl: ENSRNOG00000009773) located on rat chromosome 8. The hCas9 mRNA, sgRNA(CCTTCCCCAAGTGGATGCAC), and single-strand oligonucleotide donor (ssODN: TTCCATGTGACCATTGGGCACACAGCACTGTCTCTCTACACCGACTGCCCCTTCCCCAAGGGGATGCACTGGGCTCTGATCGCCTATGCCATCAGCTTCATCTTCCTCTTCCTCAACTTCTAC) were co-injected into Long-Evans rat zygotes at the laboratories of Cyagen Bioscience Inc.The heterozygous F0 rats carrying c.736T>G, p.W246G, mutation were bred with with WT Long-Evans rats over several generations to breed out any potential off-target effects and to establish the heterozygous SCA34 Long-Evans rat model. Successfully generation of homozygous SCA34 rats (MUT) by breeding heterozygous rats from the different F0 lines.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for LE-Elovl4 em1cgen-/-.
No alerts have been found for LE-Elovl4 em1cgen-/-.
Source: Rat Genome Database (RGD) (RRID:SCR_006444)
Description: Database for genetic, genomic, phenotype, and disease data generated from rat research. Centralized database that collects, manages, and distributes data generated from rat genetic and genomic research and makes these data available to scientific community. Curation of mapped positions for quantitative trait loci, known mutations and other phenotypic data is provided. Facilitates investigators research efforts by providing tools to search, mine, and analyze this data. Strain reports include description of strain origin, disease, phenotype, genetics, immunology, behavior with links to related genes, QTLs, sub-strains, and strain sources.
URL: http://rgd.mcw.edu
Source Database: Rat Genome Database (RGD)
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
