Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38596327
Proper Citation: RRID:RGD_38596327
Description: Rattus norvegicus with name WI-Tbc1d4em1Gdcz from RGD.
Species: Rattus norvegicus
Notes: The mutant rats were created with CRISPR/Cas9 system. A single guide RNA (sgRNA) and protospacer adjacent motif was designed targeting coding strand: 5' GCGACAAGCGCTTCCGGCTA TGG 3' with a predicted cut site 111 bp downstream of the initiation codon. Fertilized eggs, produced by mating superovulated Wistar female rats (Envigo Hsd:WI, Strain Code 001) with Wistar males, were microinjected with sgRNA and implanted to pseudopregnant rats. A founder line carrying a 20-bp substitution deletion (TGGCGACAAGCGTTCCGGC) was selected and backcrossed with wild type Wistar outbred rats (Charles River Laboratory; Wilmington, VA) to establish heterozygous (+/-) colony. No protein product was detected from knock out T homozygous mutant (-/-) .
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for WI-Tbc1d4em1Gdcz.
No alerts have been found for WI-Tbc1d4em1Gdcz.
Source: Integrated Animals
Source Database: Rat Genome Database (RGD)
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
