Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=38549372
Proper Citation: RRID:RGD_38549372
Description: Rattus norvegicus with name SD-Eif2ak4em1 from RGD.
Species: Rattus norvegicus
Notes: The sgRNA targeted the following sequence: GGACTTCCAGGATCTGCGGC CGG on the rat Eif2ak4 was injected to the one-cell stage embryos collected from female rats (Crl:SD). The strain carrying the biallelic deletion of 152 bp in the first exon of Eif2ak4.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for SD-Eif2ak4em1.
No alerts have been found for SD-Eif2ak4em1.
Source: Rat Genome Database (RGD) (RRID:SCR_006444)
Description: Database for genetic, genomic, phenotype, and disease data generated from rat research. Centralized database that collects, manages, and distributes data generated from rat genetic and genomic research and makes these data available to scientific community. Curation of mapped positions for quantitative trait loci, known mutations and other phenotypic data is provided. Facilitates investigators research efforts by providing tools to search, mine, and analyze this data. Strain reports include description of strain origin, disease, phenotype, genetics, immunology, behavior with links to related genes, QTLs, sub-strains, and strain sources.
URL: http://rgd.mcw.edu
Source Database: Rat Genome Database (RGD)
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
