Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=158013766
Proper Citation: RRID:RGD_158013766
Description: Rattus norvegicus with name SD-Akt1em1Soar from RGD.
Species: Rattus norvegicus
Notes: This Akt mutant strain was created in zygotes from Holtzman Sprague-Dawley. Guided RNAs targeting exon 4 (target sequence: GCCGTTTGAGTCCATCAGCC; nucleotides 356-375) and exon 7 (target sequence: TTGTCATGGAGTACGCCAAT; nucleotides 712-731) of the Akt1 gene (NM_033230.3) were injected to the embryos to create a1332-bp deletion from exon 4 to exon7, resulting a premature stop of the protein.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for SD-Akt1em1Soar.
No alerts have been found for SD-Akt1em1Soar.
Source: Integrated Animals
Source Database: Rat Genome Database (RGD)
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
