Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/30134
Proper Citation: RRID:Addgene_30134
Insert Name: APP shRNA 1
Bacterial Resistance: Kanamycin
Defining Citation: PMID:18160654
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2700; Vector Backbone:pENTR; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
Comments: gcacatgaatgtgcagaatgg
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pENTR APP shRNA 1.
No alerts have been found for pENTR APP shRNA 1.
Source: Addgene