Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/22038
Proper Citation: RRID:Addgene_22038
Insert Name: shlacZ
Bacterial Resistance: Ampicillin
Vector Backbone Description: Backbone Size:7700; Vector Backbone:pRRL.SIN.cPPT.PGK.GFP; Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
Comments: shLacZ oligo sequence is: 5'-aaaaacgactacacaaatcagcgatttctcttgaaaatcgctgatttgtgtgtcg
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pRRL_H1shLacZ_PGK_eGFP_Teto.
No alerts have been found for pRRL_H1shLacZ_PGK_eGFP_Teto.
Source: Addgene
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
