Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/21978
Proper Citation: RRID:Addgene_21978
Insert Name: U6 miR-20 perfect
Bacterial Resistance: Ampicillin
Defining Citation: PMID:17694064
Vector Backbone Description: Backbone Size:5000; Vector Backbone:U6+27; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: miR-20 perfect CMV sponge and U6 sponge, 2 sites: CUACCUGCACUAUAAGCACUUUA
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for U6+27-20pf.
No alerts have been found for U6+27-20pf.
Source: Addgene