Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
Plasmid Name
pelBHisTEV
RRID:Addgene_157741 RRID Copied  
PDF Report How to cite
RRID:Addgene_157741
Copy Citation Copied
Plasmid Information

URL: http://www.addgene.org/157741

Proper Citation: RRID:Addgene_157741

Bacterial Resistance: Kanamycin

Vector Backbone Description: Backbone Size:5401; Vector Backbone:pelB-MBP (DNASU access. no. EvNO00813783); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin

Comments: - Empty vector (kanamycin-R) adds TEV-protease-removable N-terminal PelB signal sequence + His10, plus potential C-term His6. Non-leaky expression due to T7lac promoter. - Has an advantage in leaving no added amino acid residues following TEV protease cleavage of PelB signal sequence + His10. This advantage is made possible by cloning into the two BseRI restriction sites. - Subcloning requires ligation-independent cloning and use of the two BseRI restriction sites that are present in this empty vector. The two BseRI sites span a removable 432 nucleotide sequence. Cloning into the BseRI-digested vector can be achieved using a ligation-independent system that is dependent on homologous recombination, such as the Takara In-Fusion HD Cloning Plus system, which requires simply designing the PCR-derived insert (containing the protein of interest) to contain 15 bp at each end that matches the 15 bp at each end of the linearized parent vector. In other words, add these 15 bp, AACCTGTACTTCCAA, to the 5' end of the PCR FORWARD primer, and add these 15 bp, GTGGTGGTGCTCGAG, to the 5' end of the PCR REVERSE primer. - The sequence of the added N-terminus is the PelB signal sequence (M1-A22 of GenBank #AAA24848) + 13 aa linker + His10-tag + 4 aa linker + TEV protease cleavage site. The N-terminal protein sequence is: MKYLLPTAAAGLLLLAAQPAMA + MDIGINSDPNSSS + HHHHHHHHHH + PMGS + ENLYFQ*X, where * is the TEV protease cleavage site and X is the N-terminal residue of the introduced protein of interest. Note that TEV protease cleaves most efficiently when X = S, G, A, M; for other compatible residues see Kapust et al 2002, PMID 12074568. - A C-terminal His6-tag is possible: if no stop codon is included in the cloned insert, the sequence LEHHHHHH is added to the C-terminus. - The PelB signal sequence directs the protein of interest to the E. coli inner membrane. Whether the protein traverses the inner membrane is dependent on the protein of interest. - BseRI cuts 8-10 nucleotides outside of its own recognition sequence and is a non-palindromic site. The placement & orientation of the two BseRI sites eliminates all of the BseRI recognition sequence in the resulting subclone. - To verify the PCR-generated insert sequence, use sequencing primers T7 (TAATACGACTCACTATAGGG), T7-Ter (GCTAGTTATTGCTCAGCGG).

Expand All
Usage and Citation Metrics

We found {{ ctrl2.mentions.all_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location


{{ ctrl2.mentions.errors.location }}

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts

No rating or validation information has been found for pelBHisTEV.

No alerts have been found for pelBHisTEV.

Data and Source Information

Source: Addgene (RRID:SCR_002037)
Description: Non-profit plasmid repository dedicated to helping scientists around the world share high-quality plasmids. Facilitates archiving and distributing DNA-based research reagents and associated data to scientists worldwide. Repository contains over 65,000 plasmids, including special collections on CRISPR, fluorescent proteins, and ready-to-use viral preparations. There is no cost for scientists to deposit plasmids, which saves time and money associated with shipping plasmids themselves. All plasmids are fully sequenced for validation and sequencing data is openly available. We handle the appropriate Material Transfer Agreements (MTA) with institutions, facilitating open exchange and offering intellectual property and liability protection for depositing scientists. Furthermore, we curate free educational resources for the scientific community including a blog, eBooks, video protocols, and detailed molecular biology resources.
URL: http://www.addgene.org