Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/60071
Proper Citation: RRID:Addgene_60071
Insert Name: pair of multiplex gRNAs targeting EGFP
Bacterial Resistance: Ampicillin
Defining Citation: PMID:24770325
Vector Backbone Description: Backbone Marker:Joung lab (Addgene plasmid # 53370); Vector Backbone:pSQT1313; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
Comments: Left gRNA target site: AAGTTCAGCGTGTCCGGCGA Right gRNA target site: CCGTCCAGCTCGACCAGGAT
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for RFN_EGFP_47.
No alerts have been found for RFN_EGFP_47.
Source: Addgene
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
