Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
Plasmid Name
RFN_EGFP_47
RRID:Addgene_60071 RRID Copied  
PDF Report How to cite
RRID:Addgene_60071
Copy Citation Copied
Plasmid Information

URL: http://www.addgene.org/60071

Proper Citation: RRID:Addgene_60071

Insert Name: pair of multiplex gRNAs targeting EGFP

Bacterial Resistance: Ampicillin

Defining Citation: PMID:24770325

Vector Backbone Description: Backbone Marker:Joung lab (Addgene plasmid # 53370); Vector Backbone:pSQT1313; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin

Comments: Left gRNA target site: AAGTTCAGCGTGTCCGGCGA Right gRNA target site: CCGTCCAGCTCGACCAGGAT

Expand All
Usage and Citation Metrics

We found {{ ctrl2.mentions.all_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor all resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location


{{ ctrl2.mentions.errors.location }}

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts

No rating or validation information has been found for RFN_EGFP_47.

No alerts have been found for RFN_EGFP_47.

Data and Source Information

Source: Addgene