Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/44266
Proper Citation: RRID:Addgene_44266
Insert Name: K15 promoter (-4.8)
Organism: Mus musculus
Bacterial Resistance: Kanamycin
Defining Citation: PMID:15024388
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4737; Vector Backbone:pEGFP-N2; Vector Types:Mammalian Expression, Mouse Targeting, Fluorescence microscopy; Bacterial Resistance:Kanamycin
Comments: Alternate plasmid name: pEGFP-N2 K15 The K15 promoter was cloned from C57 BL/SJ mouse genomic DNA (isolated from tail) by PCR using the Supermix High Fidelity Kit (GIBCO). The sequences of the forward and reverse primers were CTGAGCTACCAGCGAGACTCC (K15F1) and TTCCTGTCCCTAGCAAGCAGGAGAG (K15R1), respectively. XhoI and EcoRI restriction sequences were added to the 5' end of forward and reverse primers respectively for subsequent cloning of the PCR product into PBK/CMV vector (Stratagene). The promoter fragment was then subcloned into pGEGFP-N2 The entire K15 promoter-EGFP transgene can be released by digestion with XhoI/AflII.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for K15-EGFP.
No alerts have been found for K15-EGFP.
Source: Addgene
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
