Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
Plasmid Name
K15-EGFP
RRID:Addgene_44266 RRID Copied  
PDF Report How to cite
RRID:Addgene_44266
Copy Citation Copied
Plasmid Information

URL: http://www.addgene.org/44266

Proper Citation: RRID:Addgene_44266

Insert Name: K15 promoter (-4.8)

Organism: Mus musculus

Bacterial Resistance: Kanamycin

Defining Citation: PMID:15024388

Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4737; Vector Backbone:pEGFP-N2; Vector Types:Mammalian Expression, Mouse Targeting, Fluorescence microscopy; Bacterial Resistance:Kanamycin

Comments: Alternate plasmid name: pEGFP-N2 K15 The K15 promoter was cloned from C57 BL/SJ mouse genomic DNA (isolated from tail) by PCR using the Supermix High Fidelity Kit (GIBCO). The sequences of the forward and reverse primers were CTGAGCTACCAGCGAGACTCC (K15F1) and TTCCTGTCCCTAGCAAGCAGGAGAG (K15R1), respectively. XhoI and EcoRI restriction sequences were added to the 5' end of forward and reverse primers respectively for subsequent cloning of the PCR product into PBK/CMV vector (Stratagene). The promoter fragment was then subcloned into pGEGFP-N2 The entire K15 promoter-EGFP transgene can be released by digestion with XhoI/AflII.

Expand All
Usage and Citation Metrics

We found {{ ctrl2.mentions.all_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor all resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location


{{ ctrl2.mentions.errors.location }}

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts

No rating or validation information has been found for K15-EGFP.

No alerts have been found for K15-EGFP.

Data and Source Information

Source: Addgene