Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/40846
Proper Citation: RRID:Addgene_40846
Insert Name: let-7–bulge9-15
Organism: Drosophila melanogaster
Bacterial Resistance: Kanamycin
Defining Citation: PMID:20558712
Vector Backbone Description: Backbone Marker:Zamore lab; Vector Backbone:pENTR/D-EGFP; Vector Types:Insect Expression, miRNA reporter; Bacterial Resistance:Kanamycin
Comments: The let-7 bulge9-15 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos: s: CTAGAACTATAGTTGGATCTACCTCAT as: CTAGATGAGGTAGATCCAACTATAGTT
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pAS-11 (bulge 9-15).
No alerts have been found for pAS-11 (bulge 9-15).
Source: Addgene