Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/29658
Proper Citation: RRID:Addgene_29658
Insert Name: None
Bacterial Resistance: Kanamycin
Vector Backbone Description: Backbone Size:5712; Vector Backbone:pET; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
Comments: This plasmid is an empty vector to be used with a LIC cloning protocol. It has a TEV-cleavable His6 fusion tag on its N-terminus. Mocr can enhance the expression and solubility of your protein of interest. To clone into this vector, add LIC fusion tags to the 5' end of your PCR primers. Forward - 5'TACTTCCAATCCAATGCA3' Reverse - 5'TTATCCACTTCCAATGTTATTA3' Linearize the plasmid with SspI and gel purify. When digesting the DNA with T4 polymerase, use dCTP for insert and dGTP for vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pET His6 Mocr TEV LIC cloning vector (1O).
No alerts have been found for pET His6 Mocr TEV LIC cloning vector (1O).
Source: Addgene
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
