Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/237425
Proper Citation: RRID:Addgene_237425
Insert Name: none
Organism: n/a
Bacterial Resistance: None
Defining Citation: PMID:40595632
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Comments: Genotype: TpR SmR recA, thi, pro, hsdR-M+RP4: 2-Tc:Mu: Km Tn7 λpir, gyrAR462C To verify the gyrA gene using the following primers: gyrA462-F: cccgtcgtactattttcgaac gyrA462-R: cagcagtcggtcgataaagtc The expected PCR product size is approximately 600 bp. If the strain carries the two characteristic mutations (one silent mutation and one Arg→Cys substitution), it is the correct strain. Please see the GenBank file in the Supplementary Documents section above for reference. Note that the strain is only resistant to low levels of Trimethoprim and Streptomycin. Please see the .PDF in the Supplementary Documents section above. Addgene Note: This strain was prepared directly from the depositor's sample without further sequence verification. We recommend verifying the strain as described above. Please contact [email protected] if any issues arise.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for S17-1λpir gyrAR462C.
No alerts have been found for S17-1λpir gyrAR462C.
Source: Addgene
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
