Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/235121
Proper Citation: RRID:Addgene_235121
Organism: Other
Bacterial Resistance: None
Defining Citation: PMID:42199375
Vector Backbone Description: Vector Backbone:n/a; Vector Types:This is a strain, not a plasmid; Bacterial Resistance:None
Comments: Genotype: E. coli B F- ompT gal dcm lon hsdSB(rB–mB–) λ(DE3 [lacI lacUV5-T7p07 ind1 sam7 nin5]) [malB+]K-12(λS) ΔendA ΔrecA glvC ::[ phlFAM, cymRAM, luxR, vanRAM, lacIAM, tetR ] Fast growth at 37C in LB (doubling time ~ 20-25 minutes) and improved DNA (endA, recA) and protein stability (lon, ompT). Strain validation: - PCR using OR1965 (TGGCGTAAAGGTGCTTCC) and OR1960 (ATAACCAATCAGGCTTCCTACTTACAGAATTG) generates a product of 5 518 bp. - PCR using OR1965 (TGGCGTAAAGGTGCTTCC) and OR1160(GCTTGTCGACGACGGC) generates a product of 140 bp. - PCR using OR1157 (TACCCCAGTTGGGGCAC) and OR1960 (ATAACCAATCAGGCTTCCTACTTACAGAATTG) generates a product of 110 bp. Please visit https://doi.org/10.1101/2025.10.29.680610 for bioRxiv preprint.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for SB39.
No alerts have been found for SB39.
Source: Addgene
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
