Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/22694
Proper Citation: RRID:Addgene_22694
Insert Name: miR-31
Organism: Homo sapiens
Bacterial Resistance: Ampicillin
Defining Citation: PMID:19524507
Vector Backbone Description: Backbone Marker:Weinberg lab (Addgene#:1764); Backbone Size:5169; Vector Backbone:pBABE-puro; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
Comments: Useful for stable suppression of miR-31 function. Original sponge backbone modifed from Ebert et al., Nat. Methods (2007); miR-31 construct and stable design are novel Repeated sequence is: AGGCAAGACGAGGCATAGCT *Addgene sequencing found at least partial EGFP upstream of the sponge. We do not know if the EGFP is functional or a side-product of the cloning.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pBABE-puro-mIR-31 sponge.
No alerts have been found for pBABE-puro-mIR-31 sponge.
Source: Addgene
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
