Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/176584
Proper Citation: RRID:Addgene_176584
Insert Name: pRARE2 + pBADmod1-linker2-gamS plasmid
Bacterial Resistance: Chloramphenicol and Ampicillin
Defining Citation: PMID:35034449
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:; Bacterial Resistance:Chloramphenicol and Ampicillin
Comments: Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for genomic verification: Foward - tattttccagtcgtgaaagc Reverse - ttgctgatttcttccatcag Primers for GamS plasmid verification: Forward - aattatgacaacttgacggctacatcattc Reverse - cgttcaccgacaaacaaca
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for BL21 Rosetta2 GamS.
No alerts have been found for BL21 Rosetta2 GamS.
Source: Addgene