Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/164956
Proper Citation: RRID:Addgene_164956
Insert Name: kcnn1a
Organism: Danio rerio
Bacterial Resistance: Kanamycin
Defining Citation: PMID:33728688
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR-D-TOPO; Vector Types:PCR cloning vector; Bacterial Resistance:Kanamycin
Comments: The DNA sequence was amplified from pooled wild-type TAB zebrafish embryos. According to the predicted sequence, XP_005171293.1, there are likely polymorphisms, K185E, H323Y, S599N, which are not listed in the current ENSEMBL database. This is possibly due to incomplete zebrafish genome annotation, GRCz11. In addition, at the 5’ end of the insert, there are 44bps extra forward primer dimer sequences (ATGCGGCATCGGCACGCGGGCCATGCGGCATCGGCACGCGGGCC) before the start codon. But this will not impact the result of the whole mount in situ hybridization.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for all resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pENTR-D-TOPO-kcnn1a.
No alerts have been found for pENTR-D-TOPO-kcnn1a.
Source: Addgene
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
