Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/157739
Proper Citation: RRID:Addgene_157739
Bacterial Resistance: Ampicillin
Vector Backbone Description: Backbone Size:5942; Vector Backbone:pET PPL His6 MBP LIC cloning vector (2K-T) = Addgene #37183; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
Comments: - Empty vector for cytoplasmic expression of N-terminally His10+MBP-tagged protein of interest, where tag removal by TEV protease yields the native sequence for the protein of interest. - Based on plasmid pET PPL His6 MBP LIC cloning vector (2K-T) (Plasmid #37183), but has the added advantage in leaving no added amino acid residues following cleavage with TEV protease. This advantage is made possible by cloning into the two BseRI restriction sites. - Subcloning requires ligation-independent cloning and use of the two BseRI restriction sites that are present in this empty vector. The two BseRI sites span a removable 432 nucleotide sequence. Cloning into the BseRI-digested vector can be achieved using a ligation-independent system that is dependent on homologous recombination, such as the Takara In-Fusion HD Cloning Plus system, which requires simply designing the PCR-derived insert (containing the protein of interest) to contain 15 bp at each end that matches the 15 bp at each end of the linearized parent vector. In other words, add these 15 bp, AACCTGTACTTCCAA, to the 5' end of the PCR FORWARD primer, and add these 15 bp, CGCGATCGCGGATCC, to the 5' end of the PCR REVERSE primer. - The sequence of the added N-terminus is MKSS + His10 + GSSM + maltose binding protein (aa K27-T392 of NP_290668) + NSSSNNNNNNNNNNLGIE + ENLYFQ*X, where * is the TEV protease cleavage site and X is the N-terminal residue of the introduced protein of interest. Note that TEV protease cleaves most efficiently when X = S, G, A, M; for other compatible residues see Kapust et al 2002, PMID 12074568. - The maltose binding protein tag is the mature form, without its signal sequence, therefore protein expression is directed to the cytoplasm. - BseRI cuts 8-10 nucleotides outside of its own recognition sequence and is a non-palindromic site. The placement & orientation of the two BseRI sites eliminates all of the BseRI recognition sequence in the resulting subclone. - To verify the PCR-generated insert sequence, use sequencing primers MBPpelBseqF (GAAAGGTGAAATCATGCCGAACATC), and pET-PPLseq1R (CTTCCTTTCGGGCTTTGTTAGC) or T7-Ter (GCTAGTTATTGCTCAGCGG).
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pMBPcyto-TEV-BseRI.
No alerts have been found for pMBPcyto-TEV-BseRI.
Source: Addgene