Resource Summary Report  New Search

URL: http://www.addgene.org/157736

Proper Citation: RRID:Addgene_157736

Bacterial Resistance: Ampicillin

Defining Citation: PMID:33971243

Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4682; Vector Backbone:pFastBac1; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin

Comments: - This vector is designed to avoid adding non-native amino acid residues to the protein of interest, following enterokinase cleavage of the N-terminal purification tags (His10 and 3xFLAG). Subcloning requires ligation-independent cloning and use of the two BseRI restriction sites that are present in this empty vector. The two BseRI sites span a removable 432 nucleotide sequence. Cloning into the BseRI-digested vector can be achieved using a ligation-independent system that is dependent on homologous recombination, such as the Takara In-Fusion HD Cloning Plus system, which requires simply designing the PCR-derived insert (containing the protein of interest) to contain 15 bp at each end that matches the 15 bp at each end of the linearized parent vector. In other words, add these 15 bp, GATGACGATGACAAG, to the 5' end of the PCR FORWARD primer, and add these 15 bp, AGTACTTCTCGACAA, to the 5' end of the PCR REVERSE primer. - The sequence of the N-terminus will be MGSS + His10 + DYKDHDGDYKDHDIDYKDDDDK*X, where * is the enterokinase cleavage site and X is the N-terminus of the protein of interest. For X residues that are compatible with enterokinase activity, see Hosfield & Lu 1999, PMID 10094769. - BseRI cuts 8-10 nucleotides outside of its own recognition sequence and is a non-palindromic site. The placement & orientation of the two BseRI sites eliminates all of the BseRI recognition sequence in the resulting subclone. - An unwanted BseRI site was removed from the parent pFastBac1 vector by introducing a silent mutation (CTC to CTG) in a leucine codon in the gentamicin-resistance gene. - To identify colonies containing a cloned insert, used the primers PFASTBAC1F (CTAGTGGTTGGCTACGTATACTCCG) and PFASTBAC1R (GGACAAACCACAACTAGAATGCAGTG). - To verify the PCR-generated insert sequence, use sequencing primers POLYHEDF (AAATGATAACCATCTCGC), SV40PAR (GAAATTTGTGATGCTATTGC). - To verify Tn7-based incorporation of the expression construct into the bacmid DNA in the E. coli strain DH10Bac, use PCR primers BACM13F (CCCAGTCACGACGTTGTAAAACG) and BACM13R (AGCGGATAACAATTTCACACAGG). A bacmid containing the correct insert has a PCR product size of ~2300 base pairs plus the length of the added insert.

Expand All Collapse