Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/11049
Proper Citation: RRID:Addgene_11049
Insert Name: HRPT2 136X
Organism: Homo sapiens
Bacterial Resistance: Ampicillin
Defining Citation: PMID:15632063
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
Comments: Author has deposited insert sequence. Click on "sequence" to view. Cloned using the following primers 5' CGGGATCCATGGCGGACGTGCTTAGCGT 3' and 5' CCGCTCGAGCTATGCTTCTGCTAAAACTTC 3' and ligated into pcDNA3 HRPT2 that had been digested with BamHI & XhoI (which removes full-length HRPT2, but leaves the flag tag at the N-terminus. See plasmid 11048 to learn how pcDNA3 HRPT2 was constructed).
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
Check
for resource mentions.
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for pcDNA3 HRPT2 136X.
No alerts have been found for pcDNA3 HRPT2 136X.
Source: Addgene (RRID:SCR_002037)
Description: Non-profit plasmid repository dedicated to helping scientists around the world share high-quality plasmids. Facilitates archiving and distributing DNA-based research reagents and associated data to scientists worldwide. Repository contains over 65,000 plasmids, including special collections on CRISPR, fluorescent proteins, and ready-to-use viral preparations. There is no cost for scientists to deposit plasmids, which saves time and money associated with shipping plasmids themselves. All plasmids are fully sequenced for validation and sequencing data is openly available. We handle the appropriate Material Transfer Agreements (MTA) with institutions, facilitating open exchange and offering intellectual property and liability protection for depositing scientists. Furthermore, we curate free educational resources for the scientific community including a blog, eBooks, video protocols, and detailed molecular biology resources.
URL: http://www.addgene.org
The NIDDK Information Network (dkNET) serves the needs of basic and clinical investigators by providing seamless access to large pools of data and research resources relevant to the mission of The National Institute of Diabetes Digestive and Kidney Diseases (NIDDK). dkNET is hosted at University of California San Diego, and is supported by NIH NIDDK grant U24DK097771.
Email: info_at_ dknet.org
